Báo cáo khoa học: "Bootstrapping a Unified Model of Lexical and Phonetic Acquisition" potx
Báo cáo khoa học: Adenine, a hairpin ribozyme cofactor – high-pressure and competition studies potx
... buffer were obtained from Fermentas
(St Leon-Rot, Germany).
RNA preparation
The sequence of primer P1 (promoter primer) is 5¢-TAATA
CGACTCACTATAGGGTACGCTGAAACAGA-3¢, and
that of primer P2 (reverse ... world’
or in an early stage of the development of life, when
small RNA would have played a major role. Popula-
tions of small RNA could have interacted randomly
with small metaboli...
Báo cáo khoa học: "Bootstrapping a Stochastic Transducer for Arabic-English Transliteration Extraction" pdf
... 2002) or
(AbdulJaleel and Larkey, 2003) require a large set of
sample transliterations to use for training. If such a
training set is unavailable for a particular language
pair, a detection algorithm ... transliterations of the units are assessed
manually from a set of training pairs. For each
katakana string in a bitext, all possible translitera-
tions are produced based...
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
... in both
answers, and AllIds is the number of different ids
in both answers. We calculated the overall average
agreement ratio (Total Avg) and the average of the
best matches between two assignments ... human evaluation (Lin and Hovy,
2003).
Overlaps of higher order N-grams are more usable
within speech summarisation as they take the gram-
matical structure and fluency of the su...
Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf
... were analyzed manually
and automatically by
SEQUEST
software. The acquisition
and deconvolution of data were performed with the
XCALI-
BUR
software on a Windows NT PC data system.
Determination of ... obtained from data bank and the abbreviations stand for: AaH, Androctonus australis
Hector; Amm, Androctonus mauretanicus mauretanicus;Bj,Buthotus judaicus;Bot,Buthus occitanus tunet...
Báo cáo khoa học: "SITS: A Hierarchical Nonparametric Model using Speaker Identity for Topic Segmentation in Multiparty Conversations" pptx
... patterns of agree-
ment and disagreement (Hawes et al., 2009; Abbott
et al., 2011), and relationships among conversational
participants (Ireland et al., 2011).
One of the most natural ways to capture ... al.,
2010) and tools that summarize (Murray et al., 2005)
and display (Ehlen et al., 2007) conversational data.
Topic segmentation also can illuminate individuals’
agendas (Boydst...
Báo cáo khoa học: "Towards a Semantic Classification of Spanish Verbs Based on Subcategorisation Information" doc
... classifica-
tions. The baseline is calculated, for each task, as
the average value of the Adjusted Rand measure for
100 random cluster assignations. Although all the
tasks perform better than the baseline, ... value of all the data
points, in order to get an indication of the overall
quality of the clusters created. The main difficulty in
evaluating unsupervised classification tasks agai...
Báo cáo khoa học: "Combining a Statistical Language Model with Logistic Regression to Predict the Lexical and Syntactic Difficulty of Texts for FFL" potx
... we add
two NLP-oriented features, as described below: a
statistical language model and a measure of tense
difficulty.
4.1 The language model
The lexical difficulty of a text is quite an elaborate
phenomenon ... investigation.
This research is still in progress, and further
analyses are planned. The predictive capacity of
some other lexical and grammatical features will...
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx
... Ala
L6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala
2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg Arg37 and Arg40 to Asn
3K > Q K64Q F caggacagtctgcagcaggttgaacaagcgagcctcac ... gctttttggcaccaaaaaggccggctccatcg Leu25 to Ala
G3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to Ala
F3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg Phe39 to Ala
3K > Q K37Q F g...
Tài liệu Báo cáo khoa học: "Methods for the Qualitative Evaluation of Lexical Association Measures" doc
... Evaluation of
Association Measures
2.1 State -of- the-art
A standard procedure for the evaluation of AMs is
manual judgment of the -best candidates identi-
fied in a particular corpus by the measure ... among
low-frequency data.
(2) The evaluation strategies applied: Instead
of examining only a small sample of
-best can-
didates for each measure as it is common practice,
we mak...
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... Subbuswamy K. Prabu
1,
*, Cynthia M. Otto
2
and Narayan G. Avadhani
1
1
Department of Animal Biology and
2
Department of Clinical Studies, School of Veterinary Medicine, University of Pennsylvania,
Philadelphia, ... with Apo-ferritin and
b-amylase. Based on the rates of migration, the slow
migrating complex may be a dimmer and the faster
migrating complex migrating with an...
Từ khóa:
- Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng
- Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế
- Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin
- Chuong 2 nhận dạng rui ro
- Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật