Báo cáo khoa học: "Development of a Stemming Algorithm" pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTCGAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCAGGGG-3¢ for the latter. The ... isolation and long-termculture of organ-speciﬁc blood vascular and lymphaticendothelial cells of the mouseTakashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki ... Ag-expressingendothelial cellpAloxP loxPpAtsA58TCAGtsA58TCAGEnzymatic digestion of organsCulture at 33 °CSerial passages every 2–3 daysat split ratio 1 : 3day 20–30day 0βgeoFig. 1. An endothelial...

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... substantianigra is a neuropathological hallmark of Parkinson’sdisease. This leads to a decreased level of dopamine inthe striatum. As a result, synaptic transmission is nega-tively affected ... MPTP andMPP+can facilitate aggregation of a- synuclein in theabsence of any cellular machinery.It has been proposed that the auto-oxidation product of dopamine interacts with protoﬁbrillar a- synucleinand ... of rasagiline, a MAO-B inhib-itor, on the aggregation of a- synuclein, is because of itsaction as a free radical scavenger [36]. Thus, it may bespeculated that dopamine exhibits a beneﬁcial...

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in ﬁssion yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 in ﬁssion yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y ... GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y...

Tài liệu Báo cáo khoa học: Application of a ﬂuorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf

... Seligman PA & Allen RH (1978) Characterization of the receptor for transcobalamin II isolated from humanplacenta. J Biol Chem 253, 1766–1772.22 Quadros EV, Nakayama Y & Sequeira JM (2005) ... University of Utah, Salt Lake City, UT, USA3 Department of Physiology and Biophysics, University of Aarhus, Denmark4 Department of Medical Biochemistry, University of Aarhus, Denmark5 Department of ... 4753Application of a ﬂuorescent cobalamin analoguefor analysis of the binding kinetics A study employing recombinant human transcobalaminand intrinsic factorSergey N. Fedosov1, Charles...

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... 5¢-CTTTAACTTGTTGGGCACTGGCATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCCCA-3¢ along with the adaptor primers: AP1 (5¢-GTAATACGACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGGCACGCGTGGT-3¢).Nested PCR was carried ... obtain the full length sequence:OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢;OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG-3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACGTG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATCGTCCC-3¢; ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTPand dTTP, 0.2 lm of upstream primer (OP17: 5¢-GAAAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) anddownstream...

Tài liệu Báo cáo khoa học: Separation of a cholesterol-enriched microdomain involved in T-cell signal transduction doc

... Ohno-Iwashita Y, Shimada Y, Waheed AA, HayashiM, Inomata M, Nakamura M, Maruya M & Iwashita S(2004) Perfringolysin O, a cholesterol-binding cytolysin,as a probe for lipid rafts. Anaerobe ... 10, 125–134.19 Waheed AA, Shimada Y, Heijinen HFG, Nakamura M,Inomata M, Hayashi M, Iwashita S, Slot JW & Ohno-Iwashita Y (2001) Selective binding of perfringolysin Oderivative to cholesterol-rich ... clustering and segregation of Lck and LAT onthe inner leaﬂet of the plasma membrane [12]. Thesemorphological analyses suggest the existence of raftsubsets. There are some biochemical approaches...

Tài liệu Báo cáo khoa học: "Demonstration of a POMDP Voice Dialer" ppt

... WilliamsAT&T Labs – Research, Shannon Laboratory180 Park Ave., Florham Park, NJ 07932, USAjdw@research.att.comAbstractThis is a demonstration of a voice di-aler, implemented as a partially observableMarkov ... state feature vectors. During opti-mization, a set of template state feature vectors aresampled, and values are computed for each actionmnemonic at each template state feature vector.Finally, ... beliefstate. Initially, all of the belief is held by the mas-ter, undifferentiated partition, which is shown as a green bar and always shown ﬁrst. As names are rec-ognized, they are tracked separately,...

Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf

... 5¢-GAGCCCGGATCCACCATGAAGGTCTCAATAATT 3¢;3¢ primer, 5¢-CTGACG GAATTCTTAAACATTAATGCC 3¢. These primers encoded a Kozak consensus sequence as well as BamHI and EcoRIrestriction sites. The PCR-ampliﬁed ... observed with M. brassicae CSPMbraA6[32]. We observed also that BrC15-Ac was able to displaceASA, suggesting that brominated fatty acid and ASA bothassociated with W81 in the same ligand binding ... Pichia pastoris. Sinapinic matrix adducts are shown.Fig. 3. Electrophoretic analysis and puriﬁcation of recombinant ASP3c. (A) SDS/PAGE analysis of recombinant ASP3c secreted by Pichiapastoris....

Tài liệu Báo cáo khoa học: "DESIGN OF A KNOWLEDGE-BASED REPORT GENERATOR" doc

... pattern-recognition nature of these grammar rules and their use of the lexicon, they may be viewed as a high-level variant of a lexical functional grammar. 5 The efficacy of a low-level functional grammar for ... sublanguage, but it also reveals the essential semantic classes and attributes of a domain of discourse, as well as the relations between those classes and attributes. Thus, samples of actual ... lexicon, clausal grammatical categories, and a clause-combining grammar, provide an appropriate level of knowledge representation for gen- erating that type of text which may be categorized as periodic...

Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

... GTCGGATCCGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp,GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢OSalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA;and rnc3¢I comp, TGAACCCCATCATCCACTGCCAGGTCAGCG. The deletion was constructed ... follows: era_F_NcoI, CGACCATGGCGAACAGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGACAGCCTTCCATCGGAGTTACT. The resulting vectorwas termed pTrc9 9a: :era. Protein overexpression wasassayed by SDS ⁄ PAGE.Selection ... Kitagawa M, Ara T, Arifuzzaman M, Ioka-NakamichiT, Inamoto E, Toyonaga H & Mori H (2005) Completeset of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive):...

Xem thêm