Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
Báo cáo khoa học: Identification of amino acids in antiplasmin involved in its noncovalent ‘lysine-binding-site’-dependent interaction with plasmin pptx
... Identification of amino acids in antiplasmin involved in its noncovalent‘lysine-binding-site’-dependent interaction with plasminHaiyao Wang, Anna Yu, Bjo¨ rn Wiman and Sarolta PapDepartment of Clinical ... suggeststhat the lysine-binding-site-dependent interaction betweenantiplasmin and plasmin occurs in the C-terminal part of antiplasmin. It is also known that antiplasmin has a lysine as the C-terminal ... between plasminand the antiplasmin variants are shown in Table 3 (in both the presence and absence of 6-aminohexanoic acid). The reactions between ‘native’ human antiplasmin and plasmin in the presence...
- 7
- 292
- 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAGHC-K 7A GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAGMG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCCT3 ... ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCCMG6S GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCCMG6X GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGACMG3X ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGACXHO-TNF13 ... 3 and 6 on protein N-myristoylation, sequential vertical-scanning mutagenesis of the amino acids at positions 3 and 6 in a model substrate protein having a sequence MGAAAAAAAA at itsN-terminus...
- 12
- 512
- 0
Báo cáo khoa học: Biological role of bacterial inclusion bodies: a model for amyloid aggregation potx
... architecture of IBproteins [14,15] has led to the use of these underesti-mated bacterial aggregates as intriguing models for the analysis of protein protein interactions in the context of amyloid and ... non-natural amino acids. This observation, which indicated the transientnature of protein aggregates formed by conformation-ally aberrant proteins, was more recently repeated withbacterial IBs ... chains in the sequence, such as occurs in protein folding, plays a pivotal role in determining the conformational properties of the Biological role of bacterial inclusion bodies E. Garcı´ a- Fruito´s...
- 9
- 432
- 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt
... PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the forwardand reverse oligonucleotide primers, respectively. The primers were designed to introduce ... histidine-containing motifs separated by a variable intermotifregion provide the signature for the superfamily andcontribute the residues for metal binding [1,2]. A widerange of catalytic functions, spanning ... the fundamental question of how the structures of cupin proteins determine metal-binding recognitionas well as reactivity in chemical transformations. Func-tional annotation of cupin proteins...
- 15
- 624
- 0
Tài liệu Báo cáo khoa học: Structural characterization of Ca2+/CaM in complex with the phosphorylase kinase PhK5 peptide pdf
... sites. In the case of the titin and twitchinkinases, the autoinhibitory sequence acts as a pseudo-substrate, occluding ATP binding and preventing protein substrates from binding (reviewed in [9]).PhK ... An intrinsic calmodulin (CaM, the dsubunit) binds directly to the c protein kinase chain. The interaction site of CaM on c has been localized to a C-terminal extension of the kinasedomain. ... role in Ca2+-regulated control of PhK activitythrough the formation of a classical ‘compact’ CaM complex.AbbreviationsCaM, calmodulin; CaMK, CaM kinase; CaMKK, CaM kinase kinase; eNOS, endothelial...
- 12
- 590
- 0
Tài liệu Báo cáo khoa học: Improving Classification of Medical Assertions in Clinical Notes" pdf
... Biological, translational, and clinical language pro-cessing, Prague, CZ. David Ferrucci and Adam Lally. 2004. UIMA: An Ar-chitectural Approach to Unstructured Information Processing in the Corporate ... substantial recall gains on the minority classes. 1 Introduction Since the beginning of the new millennium, there has been a growing need in the medical community for Natural Language Processing ... Each binary feature has a value of true if the average tf-idf score is smaller than a threshold (e.g. 0.5 for the medical term itself), or false otherwise. Finally, we created another binary...
- 6
- 496
- 0
Tài liệu Báo cáo khoa học: "Topological Ordering of Function Words in Hierarchical Phrase-based Translation" pdf
... Proceedings of the 47th Annual Meeting of the ACL and the 4th IJCNLP of the AFNLP, pages 324–332,Suntec, Singapore, 2-7 August 2009.c2009 ACL and AFNLP1 2 3 1123{ }324X ... X a XdXbX a XbXd≺X a ≺ Xb≺ Xc≺ Xd≺ XeXd≺ X a ≺ Xb≺ Xc≺ XeXd ≺ ≺ ≺ ≺ d(Y, Y)326 ❄❳❳❳❳❳③✘✘✘✘✘✾❄❄ ❄ ❄X a ⇒ ... ∼) =ifλiifiλi˜e˜fPtrans(˜f|˜e) Ptrans(˜e|˜f)Plex(˜f|˜e) Plex(˜e|˜f)eD∗eD∗= P (D), D e.D = Xi, i ∈ 1 |D|325X a → X1, X1Xb→ X1 X2,...
- 9
- 471
- 1
Tài liệu Báo cáo khoa học: Enhanced expression of Mcm proteins in cancer cells derived from uterine cervix docx
... extracts (data not shown). The intensity of the Mcm4band was clearly decreased at 22 h chase in both HeLa and WI-38 cells, indicating the presence of turnover of the protein. Quantitation of the ... over-replication in Saccharomyces cerevisiae [20]. These findings indicate thatMcm proteins play a role in regulating the replication of DNA. The gene amplification that has been detected in various cancer ... were quantitated in each protein, the concentrations of these proteins in total and chromatin-bound fraction were determined. The relative ratio (HeLa/WI) in the concentration was calculated....
- 13
- 486
- 0
Tài liệu Báo cáo khoa học: "Automatic Detection of Nonreferential It in Spoken Multi-Party Dialog" doc
... described in the followingwere obtained fully automatically. That meansthat errors in the shallow feature generation meth-ods could propagate into the model that waslearned from the data. The advantage ... identified andcorrected. The annotators then individually per-formed the actual annotation again. The resultsreported in the following are from this second an-notation.We then examined the inter-annotator ... inter-annotator reliability of the annotation by calculating the κ score (Car-letta, 1996). The figures are given in Table 1. The category other contains all cases in which one of the minor categories...
- 8
- 436
- 0
Báo cáo khoa học: Therapeutic targeting of molecules involved in leukocyte–endothelial cell interactions potx
... used for the treatment of graft-versus-host disease and suppressesatopic dermatitis in animal models [6,25]. Efalizumab is a humanized IgG1 mAb that also targets the CD1 1a chain of LFA-1 and ... LFA-1 from interacting withICAM-1. E falizumab has b een successfully used in phaseIII clinical trials in patients with psoriasis [26]. Natal-izumab (tysabri), a mAb to the a4 integrin chain ... proteases, lipids and a wide variety of other molecules involved in inflammation. Multiplechemokines play critical roles in the initiation andperpetuation of in ammatory diseases. Activation of chemokine...
- 9
- 330
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP