... traction.
The IFC clearly has the potential to play an important catalytic
role in the objective of engaging the private sector in Climate
Change Adaptation by both managing a private sector ...
Climate Change and the Insurance Sector 32
Case Study on Crop Insurance in India 34
Potential Strategies to Engage the Private Sector in Cli...
... agreement in hedging against the market risk?
We can increase the measures in each group to make the analysis more accurate, but it
would also complicate the model. We have to make the tradeoff ... priority interest in the security proceeds in any event.
2.2.5 Other actors
The arranger. The bank, which has arranged the financing, and syndication of lending will
n...
... CP-pyk
(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT
GACANNNNNNNNNNNNNNTGRTATAATNNNNAA
GTAATAAAATATTCGGAGGAATTTTGAAATGAATA
AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-
back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG
TC-3¢) ... (5¢-TGGTACTCGAG
CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG
AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and
downstream to pyk using primer pyk3 (5¢-GGAAGGA
TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk...
... and a decline in credit to the private sector could
result from a sudden stop in foreign capital in ows into the country (Calvo, 1998). In this case,
the decline in credit to the private sector ... variables are missing, other weights
can be re-scaled to compensate for missing variables. In this way, some of the gaps in the data may
be filled, which...
...
investigators. There are many existing data management offices and databases that could
support ocean acidification observational and research data.
The FOARAM Act also calls for an “Ocean ... metadata) to researchers now and in the future.
Other large-scale research programs have developed data policies that address data quality,
access, and archiving to enhance the value of...
... a slogan is a visible feature of a brand. There can be a
strong link between a slogan and a brand. The slogan and jingle are powerful and
can be a great change for a brand.
• Be different and ... competitor. Prasad and dev (2000) noted that a brand can also be said to include
all tangible and intangible attributes that the business stands for. According to Kelle...
... discharged to the river is high. They are willing
to pay about half as much to increase the treatment capacity of the STP
to treat all the wastewater generated by the municipality with primary
treatment. ...
disposable incomes compared to national standards, they are willing to
pay higher taxes for improvements in the quality and quantity of the
wastewater trea...
... crucial. It is also imperative that all
information regarding AMR and treatment failures is used to inform and update
the national and international treatment guidelines on a regular basis. Finally, ... and the data used to inform
national medicines policy and updating of standard treatment guidelines.
3.6 Laboratory capacity strengthening
Establishing a network of laboratories...
... (causing another
lysosomal storage disease) were shown to be folding
and trafficking mutants [16] before this was explored
as a possibility in GD. Galactose administration
increased Q279E a- galactosidase ... a- galactosidase A residual activity in
patient derived cells; thus, galactose was demonstrated
to be first active-site-directed pharmacologic chaperone
for a lysosomal sto...