Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx
Báo cáo khoa học: Enzymatic oxidation of NADP+ to its 4-oxo derivative is a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases potx
... a side-reaction displayed only by the adrenodoxin reductase type of ferredoxin-NADP+ reductases Matteo de Rosa1, Andrea Pennati1, Vittorio Pandini1, Enrico Monzani2, Giuliana Zanetti1and Alessandro ... of the product of NADP+ oxidation. Results and DiscussionNADPO isolation, quantitation, and spectralcharacterizationIn order to study the kinetics of NADP+ oxidation to NADPO catalyzed by ... mixturewhere FprA was incubated with NADP+in air. AsFig. 1. Hypothetical mechanism of the reductive half-reaction of the catalytic cycle of FprA in the oxidation of NADP+ to yieldNADPO. The reaction...
- 10
- 406
- 0
Tài liệu Báo cáo khoa học: "Using Automatically Transcribed Dialogs to Learn User Models in a Spoken Dialog System" doc
... For each user action A t, the ASR engine produces a hypothesis˜ A t of what the user said, drawn from a distribution Pr(˜ A t| A t),which is the ASR confusion model. The user stateUt is ... Concretely, the val-ues of St, Ut, A tand˜ A tare all assumed to belong to finite sets, and so all the conditional distributionsin our model are multinomials. Hence θ is a vec-tor that parameterizes ... directory systemand provide the name of a callee they wish to beconnected to. The system then requests additional122information from the user, such as the callee’s lo-cation and type of phone...
- 4
- 470
- 0
Tài liệu Báo cáo khoa học: Enzymatic and electron paramagnetic resonance studies of anabolic pyruvate synthesis by pyruvate: ferredoxin oxidoreductase from Hydrogenobacter thermophilus doc
... Ozawa Y, Nakamura T, Kamata N, Yasujima D,Urushiyama A, Yamakura F, Ohmori D & Imai T(2005) Thermococcus profundus 2-ketoisovalerateferredoxin oxidoreductase, a key enzyme in the archaealenergy-producing ... donorsfor this key reaction [8].POR is distributed among archaea, bacteria andanaerobic protozoa, and is a member of the 2-oxoacidoxidoreductase (OR) family, which catalyzes the oxida-tive decarboxylation ... catalytic mechanism for the reductive carboxylation of acetyl-CoA catalyzed by POR. The HE-TPP radical is illustrated on the basis of the model proposed by Barletta et al. [57] with the unpaired...
- 10
- 619
- 1
Tài liệu Báo cáo khoa học: Enzymatic properties of wild-type and active site mutants of chitinase A from Vibrio carchariae, as revealed by HPLC-MS pptx
... 5¢-CAGCCGCCGTAGAAGTTGTAAGTCATCGCAAAG-3¢,5¢-CGCCGCCACCAGGGAACATCCAGTCAATATCTAC-3, and 5¢-GCCGCCACCAGGGAATTGCCAGTCAATATCTAC-3¢, respectively.Confirmation of the mutated nucleotides by automatedsequencing was carried ... In the case of the E315Q mutant, an additional faint band was alsoseen at an Mr of 43 000. This band appeared as a degradation product during freezing and thawing of the protein that was stored ... chitinase A from V. carchariae .A combination of HPLC and ESI MS allowed the separ-ation of a and b anomers and all chitooligosaccharideproducts to be monitored simultaneously. At the initialstage...
- 11
- 592
- 0
Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt
... EcoRItr-SpsB5 TACATATGCACCATCACCATCACCATATTGTTACACCATATA NdeIpIsaA5 TACCATGGCACATCACCATCACCATCACAAAAAGACAATTATGGC NcoIIsaA3Myc TAGAATTCTTACAGATCCTCCTCTGAGATGAGCTTCTGCTCGAATCCCCAAGCACCTAAACC EcoRIRao ... sequence is shown in bold.Oligonucleotide Sequence (5¢ -to3 ¢) Restriction sitefl-SpsB5 TACATATGCACCATCACCATCACCATAAAAAAGAATTATTGGAATGGATTATTTC NdeIfl-SpsB3 TAGAATTCTTAATTTTTAGTATTTTCAGG EcoRItr-SpsB5 ... server [24]), andnon-indication as a general protease. The latter is notdesirable because it could degrade the SPase itself.Pre-IsaA was selected as the substrate for this assay.IsaA was first identified...
- 13
- 464
- 0
Báo cáo khoa học: Alpha-oxidation of 3-methyl-substituted fatty acids and its thiamine dependence pptx
... tetrahydrofolate pathway, important inone carbon-metabolism [34]. The data on aminotriazoleindicate that at least in the rat the catalase pathway is of noparamount importance, and suggest that the ... had little effect on the conversion of 14C-formate to CO2(but decreased the rates of a -oxidation by 90%). In ratformate is metabolized by two pathways: the catalasepathway and the tetrahydrofolate ... first(activation) and last (aldehyde dehydrogenation) enzymatic steps.Degradation of 3-methyl-branched fatty acids The classic catabolic pathway by which fatty acids aredegraded is b -oxidation and a...
- 9
- 567
- 0
Báo cáo khoa học: Enzymatic toxins from snake venom: structural characterization and mechanism of catalysis ppt
... changing the target of the physiologicalattack [138]. The acidic component of vipoxin is a nat-ural inhibitor of the basic and catalytically activePLA2. In the absence of the PLA2-like ... non-enzy-matic subunit has a heavy chain (consisting of A1 and A2 domains) and a light chain (consisting of A3 , C1and C2 domains) that are held together by non-cova-lent interactions. Similar to FVa, ... of mammalian enzymes.For example, prothrombin activators isolated fromAustralian snake venoms are similar to mammalianblood coagulation factors. Group D prothrombin acti-vators are similar...
- 33
- 436
- 0
Báo cáo khoa học: Enzymatic characterization and molecular modeling of an evolutionarily interesting fungal b-N-acetylhexosaminidase pot
... observed a change in the dis-tance from atom O28 (at the C3 atom of the pyranosering) of this non-reducing sugar to the catalytic asparticacid (Asp) responsible for proper orientation of the acetyl ... moved by morethan 0.3 nm.Most (83.5%) of the amino acid residues are plottedin the favourable regions of the Ramachandran plot. The deviation of geometrical parameters from idealvalues (G-factors) ... as is the fact that the ratio of GalNA-case to GlcNAcase activities is highly dependent on the concentration of the particular substrates. Second, the inhibition of the enzyme by its hydrolytic...
- 16
- 429
- 0
Báo cáo khoa học: Enzymatic features of the glucose metabolism in tumor cells ppt
... Yoshikawa T, Marat D, Doi C, MakinoT, Fukuzawa K, Tsuburaya A, Satoh S, Ito T & Mits-use S (1998) Insulin resistance in cancer patients is associated with enhanced tumor necrosis factor-alphaexpression ... example, in intact mitochondria and with suffi-cient availability of oxygen the rate of oxidative phos-phorylation is determined by the ATP ⁄ ADP ratio, not by the capacity of the respiratory ... normoxia to hypoxia may give rise to an increase of ROS produc-tion, probably at the level of complex III of the respi-ratory chain [236]. mtDNA is more vulnerable to damage than nDNA because...
- 24
- 454
- 0
Báo cáo khoa học: Enzymatic actions of Pasteurella multocida toxin detected by monoclonal antibodies recognizing the deamidated a subunit of the heterotrimeric GTPase Gq potx
... conducts the deamidation reaction. However, the enzymatic characteristics of PMT have not been analyzed as a result of the lack of an easily-administered assay to detect activity of the toxin.In the present ... shown that Gi2was activated by the deamidation of Gln205 to Glu by PMT from a cell-based assay and MS [15,16]. Gaqwasalso considered to be deamidated by the toxin. The deamidated GTPases were ... 13and Gi)-dependentpathways, by deamidating a glutamine residue in the a subunit of theseGTPases. However, the enzymatic characteristics of PMT are yet to beanalyzed in detail because the...
- 11
- 378
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ