0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids docx

Báo cáo khoa học: Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids docx

Báo cáo khoa học: Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids docx

... fatty acids and Table 1. Analyses of fatty acid ratio and relative contents of n-3 PUFAs EPA, DPA, and DHA in mammary glands. Whole inguinal mammary fat pads were isolated and contents of fatty ... FEBS Activation of Stat5 and induction of a pregnancy-like mammary gland differentiation by eicosapentaenoic and docosapentaenoic omega-3 fatty acids Yiliang E. Liu1, Weiping Pu1, Jingdong Wang2, ... the effect of DPA, EPA, and DHA on acti-vation of Jak2 and Stat5. Whereas DPA and EPAactivated Jak2 and Stat5, DHA did not induce Jak2 and Stat5 phosphorylation (Fig. 2A) . We also ana-lyzed...
  • 12
  • 421
  • 0
Báo cáo khoa học: Liver receptor homolog-1 localization in the nuclear body is regulated by sumoylation and cAMP signaling in rat granulosa cells docx

Báo cáo khoa học: Liver receptor homolog-1 localization in the nuclear body is regulated by sumoylation and cAMP signaling in rat granulosa cells docx

... 5¢-GACCTGCTTCCCGATGACTTT-3¢ and antisense, 5¢-TTCCTCCAACCACAGCACATAC-3¢); UBC9(sense, 5¢-CAACAAAGAACCCTGATGGCACGA-3¢ and antisense, 5¢-GCATCCGTAGCTTGAACAAGCCTC-3¢);PIAS3 (sense, 5¢-ACTGCAGGGACCCTGCTACA-3¢ and antisense, ... 5¢-GAGAATCCAGCTTCTTTCCC-3¢ and antisense, 5¢-GGCGACACTGTATGAATTGC-3¢);SENP2 (sense, 5¢-AACAGTCTCTACAATGCGGCCA-3¢ and antisense, 5¢-CCGTGTTCCATTACAAGCAGAA-3¢);SAE1 (sense, 5¢-GACCTGCTTCCCGATGACTTT-3¢ ... 5¢-CTTGATCAGTGCTCGGGAATG-3¢); PIASxa(sense, 5¢-TGCACCTCATTCACCGTCAT-3¢ and antisense,5¢-CTCAAACGTGGGCTTAGTGTCTT-3¢); PIASxb (sense,5¢-CCTTCTACTTCCATTGCACCTCAT-3¢ and anti-sense, 5¢-AAACGTGGGCTTAGTGTCTTGAA-3¢);...
  • 12
  • 443
  • 0
Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx

Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx

... 145 , 54–59.24 Osheroff PL & Ho WH (1993) Expression of relaxinmRNA and relaxin receptors in postnatal and adult ratbrains and hearts. Localization and developmental pat-terns. J Biol Chem ... Metab 292,E913–E919.34 Hida T, Takahashi E, Shikata K, Hirohashi T, SawaiT, Seiki T, Tanaka H, Kawai T, Ito O, Arai T et al.(2006) Chronic intracerebroventricular administration of relaxin-3 ... form a midline behavior controlnetwork, and many targets of the NI, such as the med-ial septum, hippocampus, hypothalamus, mammillarycomplex and amygdala, are involved in arousal mecha-nisms,...
  • 8
  • 369
  • 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

... precisely, anFig. 4. N-terminal pegylation of G37 2A- FVIIa and FVIIa. (A) Pegyla-tion of free and TF-bound G37 2A- FVIIa and FVIIa visualized by SDS–PAGE. At each time point, a 12 lL aliquot of the reaction ... relative degree of exposurewas probed using a low-molecular-weight reagentTable 1. Kinetic constants for hydrolysis of S-2288 and activation of FX by G37 2A- FVIIa and FVIIa. Values are means ... (Protein Data Bankaccession number 1j 8a) with Asn in this position, albeitwith F,W angles far from the allowed Ramachandranregion, are virtually identical to that of FVIIa. Model-ling of Ala372(223)...
  • 11
  • 619
  • 0
Tài liệu Báo cáo khoa học: Activation of the Torpedo nicotinic acetylcholine receptor The contribution of residues aArg55 and cGlu93 ppt

Tài liệu Báo cáo khoa học: Activation of the Torpedo nicotinic acetylcholine receptor The contribution of residues aArg55 and cGlu93 ppt

... (PTMA)on activation of WT and mutant receptors were alsoinvestigated. PTMA is a poor partial agonist of theWT nAChR and it elicits a maximum current of only1.5 ± 0.1% of the ACh response (data ... that subtype. Similar data show a lack of significant effect of dTC on the aR55W and R55E mutant recep-tors (data not shown).Table 2. Effects of PTMA and dTC on WT and mutant receptors.Data ... contribution of residues aArg55 and cGlu93Ankur Kapur, Martin Davies, William F. Dryden and Susan M.J. DunnDepartment of Pharmacology, Faculty of Medicine and Dentistry, University of Alberta, Edmonton,...
  • 11
  • 517
  • 0
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

... M2-myc-EcoRI-s, 5¢-CAGAATTCatggagcagaagctgatctccgagga ggacctg ctg GTGAACAACTCCACCAACTCCTCCAACAACTCCCTGGCTCTTACAAGTCCTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCGCCTATGTTCTTATAATG-3¢. (An engineered EcoRIrecognition ... cDNA was amplified by RT-PCR using total RNAseparated from mix stage of C. elegans as a template withthe following primers: M2-goa1-s, 5¢-CATTATAAGAACATAGGCGCTACAAGGATGGGTTGTACCATGTCACAGGAAG-3¢; ... distant animalsMasaomi Minaba1, Susumu Ichiyama2, Katsura Kojima3, Mamiko Ozaki4 and Yusuke Kato11 Immune Defense Unit, National Institute of Agrobiological Sciences, Ibaraki, Japan2...
  • 9
  • 400
  • 0
Báo cáo khoa học: Activation, regulation, and inhibition of DYRK1A Walter Becker1 and Wolfgang Sippl2 pptx

Báo cáo khoa học: Activation, regulation, and inhibition of DYRK1A Walter Becker1 and Wolfgang Sippl2 pptx

... caapi and the mideastern shrub Peganumharmala (Syrian rue). Banisteriopsis is a component of hoasca (also called ayahuasca or yage´), an hallucino-genic brew of plant extracts used in shamanic ... phosphorylation and activation of ERK8. BiochemJ 394, 365–373.86 Chang L & Karin M (2001) Mammalian MAP kinasesignalling cascades. Nature 410, 37–40. Activation, regulation, and inhibition of ... LP, Poland RE, Andrade EN, Andrade EO &Mash DC (1999) Pharmacokinetics of Hoasca alkaloidsin healthy humans. J Ethnopharmacol 65, 243–256.70 Waki H, Park KW, Mitro N, Pei L, Damoiseaux R,Wilpitz...
  • 11
  • 408
  • 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCTGAGGAAACCCAGACCCAA, reverse primer CAGTAGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA;Hsp90b, forward primer GCTTGAAGCAAGCCTCGATGCCTGAGGAAGTGCACCATGGA, reverse ... constructed by PCR amplification of theHsp9 0a ORF using the forward primer AAATAAGTCGACATGCCTGAGGAAACCCAG (SalI site underlined;Hsp9 0a start codon in bold) and the reverse primer CTTCATCTGCAGTTAGTCTACTTCTTCCAT ... revealed almost instant loss of anyactin organization following Hsp90 inhibitor treatment;data not shown). After 6 h, many of these cells displayedan apparent arrest of DNA and vacuolar segregationbetween...
  • 11
  • 427
  • 0
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx

Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx

... HeLaTR/4-1BB and HeaLaTR/TRAF1, respectively. Primers for amplifying the 4-1BB and TRAF1 cDNAs were: 5¢-GAATTCAAGCTTATGGGAAACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAGCTTCACAGTTCACATCCTCCTTCTTCT-3¢ ... amplifying the hTRa1cDNA were: 5¢-CCCGGGAAGCTTCGGACCATGGAACAGAAGCCAAGCAAGGTG-3¢ and 5¢-CCCGGGGTCGACGACTTCCTGATCCTCAAAGACCTC-3¢.Inorder to overexpress 4-1BB and TRAF1 in the HeLaTRcells, the ... expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent mannerToshiko Yamada-Okabe1, Yasuo Satoh2,* and Hisafumi Yamada-Okabe1,31Department of Hygiene,2Department...
  • 10
  • 491
  • 0
Báo cáo khoa học: Activation of p21-activated kinase 1 is required for lysophosphatidic acid-induced focal adhesion kinase phosphorylation and cell motility in human melanoma A2058 cells potx

Báo cáo khoa học: Activation of p21-activated kinase 1 is required for lysophosphatidic acid-induced focal adhesion kinase phosphorylation and cell motility in human melanoma A2058 cells potx

... PAK1 activity was accessed with MBPas a substrate after immunoprecipitation with an antibodyraised against PAK1. Activation of PAK1 by LPA wasmaximalat5minincubationwith7.8-foldincrease ,and returned ... immunocomplexMBP in-gel kinase assay, as described under Materials and methods, and MBP phosphorylation was analyzed by autoradiography. Dataare presented as mean values with standard errors of three experiments.Ó ... osteo-sarcoma cells [35] and in rat ascite hepatoma cells [37]. AsRhoA was not required for LPA-induced PAK1 activation (Fig. 2A and Fig. 3), we examined the effects of PAK1 activation on LPA-induced...
  • 9
  • 305
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM