Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc
Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc
... phosphorylated by a Golgi casein kinase- like
kinase ex vivo and circulates as a phosphoprotein
in humans
Thilina Dewpura
1,
*, Angela Raymond
1,
*, Jose
´
e Hamelin
2
, Nabil G. Seidah
2
, Majambu ... propeptide at Ser47 as
assessed by MS analysis of PCSK9 immunoprecipi-
tates in the presence and absence of shrimp alkaline
phosphatase (SAP). Radiola...
Báo cáo khoa học: Visfatin is induced by peroxisome proliferator-activated receptor gamma in human macrophages pdf
... compe-
tition experiments, increasing amounts (5, 10, 50, 100 and
200-fold excess) of unlabeled visfatin–PPREwt (5¢-CAAT
AC
AGGGCAAAGATCATGGAAG-3¢) or visfatin–PPRE-
mut (5¢-CAATAC
AGGAAAAAGAAAATGGAAG-3¢) ... -dependent manner in primary
human resting macrophages and in adipose tissue macrophages, but not in
adipocytes. The threefold increase of visfatin mRNA was paralleled by an...
Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf
... used a natural language tagger which was
trained on the output of ParaMor and Morfes-
sor. The goal was to mimic each algorithm since
ParaMor is rule-based and there is no access to
Morfessor’s internally ... goal of measuring how the learning
improves with increasing experience in terms of
training set size. We want to remind the reader that
our two algorithms are aimed at small...
Báo cáo khoa học: Transport of taurocholate by mutants of negatively charged amino acids, cysteines, and threonines of the rat liver sodium-dependent taurocholate cotransporting polypeptide Ntcp docx
... catcattatcttccggtatgagaaaatcaagcctc
–R gaggcttgattttctcataccggaagataatgatg
Thr317Ala – F gcctccaaaggaccaagcaaaaattacctacaaagc
–R gctttgtaggtaatttttgcttggtcctttggaggc
Thr317Tyr – F atcaagcctccaaaggaccaatacaaaattacctacaaagctgctg
–R ... atcaagcctccaaaggaccaatacaaaattacctacaaagctgctg
–R cagcagctttgtaggtaattttgtattggtcctttggaggcttgat
Thr320Ala – F ggaccaaacaaaaattgcctacaaagctgctgcaac
–R gttgcagcag...
Báo cáo khoa học: Solution structure of 2¢,5¢ d(G4C4) Relevance to topological restrictions and nature’s choice of phosphodiester links docx
... Base pairs
in the duplex exhibit slide ()1.96 A
˚
) and intermediate values
for X-displacement ()3.23 A
˚
), as in ADNA, while their
inclination to the helical axis is not prominent. Major and
minor ... Sundaralingam
3
and Narayanarao Yathindra
1
1
Department of Crystallography and Biophysics, University of Madras, Guindy Campus, Chennai, India;
2
Department of Chemical
Sc...
Báo cáo khoa học: Huntington’s disease: roles of huntingtin-interacting protein 1 (HIP-1) and its molecular partner HIPPI in the regulation of apoptosis and transcription pptx
... the putative
promoters of caspase-1, caspase-8 and caspase-10, and increase their expressions. In turn, increased pro-caspase-8 is recruited to HIPPI–HIP-1
heterodimer and increases apoptosis. The ... apoptosis by exogenous HIPPI
in the presence of endogenous HIP-1 is mediated
through activation of caspase-8, caspase-1, caspase-9 ⁄
caspase-6, and caspase-3. Cleavage of Bid...
Báo cáo khoa học: AdipoR2 is transcriptionally regulated by ER stress-inducible ATF3 in HepG2 human hepatocyte cells pdf
... (forward 5¢-GAGATTGCACCACTGC
GCTCTA-3¢, reverse 5¢-AGCCAGAATGTCCCGTCAA
AAA-3¢) as a negative control.
Statistical analysis
All values for the luciferase activity assay are means ±
SEM. Data were analyzed ... atf3-sense,
5¢-GGTTTGCCATCCAGAACAAG-3¢; atf3-antisense, 5¢-CC
TCCCAGGAGAAGGTAAGC-3¢; adipor2-sense, 5¢-TAGC
CTTTGGTTTGCTTTGG-3¢; adipor2-antisense, 5 ¢-CATAT
CTCCAGGCGTCAACC-3¢; gapdh...
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... chelatase and dehydrogenase function [17];
interestingly, this aspartate, Asp129, is also conserved
98
kDa
M Wt
Insoluble
Total cell lysate
Periplasm
Membrane
Cytoplasm
kDa
M Wt
Insoluble
Total ... conditions is not understood. Anal-
ysis of insertional mutagenesis and complementation
work in Pseudomonas aeruginosa, Pseudomonas fluores-
cens, Paracoccus denitrificans and Pseudomonas...
Tài liệu Báo cáo khoa học: Degradation of tropoelastin by matrix metalloproteinases – cleavage site specificities and release of matrikines pptx
... of approaches to treat elastin-
degrading diseases, the aim of this study was to investigate the degradation
of the natural substrate tropoelastin by the elastinolytic matrix metallopro-
teinases ... metalloproteinase degradation of elastin,
type IV collagen and proteoglycan. A quantitative com-
parison of the activities of 95 kDa and 72 kDa gelatin-
ases, stromelysins-1 and -2 and...
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
... Escherichia coli DsbA and DsbC,
as well as the isolated catalytic a domain of PDI. Both
the PDI a domain and DsbA have a catalytic site, with
an associated substrate-binding site, but lack an inde-
pendent ... The Authors Journal compilation ª 2010 FEBS
bacitracin contains at least nine different peptides, of
which bacitracin A is the most abundant, and it is
mainly used...
Từ khóa:
- báo cáo khoa học mẫu
- báo cáo khoa học y học
- báo cáo khoa học sinh học
- báo cáo khoa học nông nghiệp
- báo cáo khoa học lâm nghiệp
- báo cáo khoa học thủy sản
- Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống
- chuyên đề điện xoay chiều theo dạng
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại
- Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng
- Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin
- Chuong 2 nhận dạng rui ro
- BT Tieng anh 6 UNIT 2
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật