Báo cáo khoa học: Ferrous Campylobacter jejuni truncated hemoglobin P displays an extremely high reactivity for cyanide – a comparative study ppt
Báo cáo khoa học: Ferrous Campylobacter jejuni truncated hemoglobin P displays an extremely high reactivity for cyanide – a comparative study ppt
... Campylobacter jejuni truncated hemoglobin P displays an extremely high reactivity for cyanide – a comparative study Alessandro Bolli1, Chiara Ciaccio2,3, Massimo Coletta2,3, Marco Nardini4, ... þ p ðð cyanide þKþ [trHb(II)]Þ2 4 cyanide ½trHb(II)ÞÞ=ð2 ½trHb(II)Þ ð11ÞData analysisData analysis was performed with the program matlab 7.0(MathWorks Inc., South Natick, MA, USA). ... Fe(II)- and Fe(III)-cya-nide complexes of the homodimeric Scapharca inaequi-valvis hemoglobin. A resonance Raman and FTIR study. Biochemistry 36, 450 5–4 509.42 Boffi A, Chiancone E, Peterson ES, Wang...
- 13
- 366
- 0
Tài liệu Báo cáo khoa học: Multi-targeted activity of maslinic acid as an antimalarial natural compound pdf
... drugs against malaria that are available or under development target a single process of the parasite infective cycle, favouring the appearance ofresistant mutants which are easily spread in areas ... aspartic protease catalytic class, waspreviously reported [12]. Accordingly, an additionalinhibition assay was performed using P. falciparumprotein extracts and including cathepsin D (an asparticprotease) ... Chait B, Cerami A & Henderson GB (1991) Hemoglobin degradation inthe human malaria pathogen Plasmodium falciparum :a catabolic pathway initiated by a specific protease. J ExpMed 173, 96 1–9 69.59...
- 11
- 682
- 0
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... thepresent study for quantitative metal analysis (GF-AAS,ICP-MS) required adaptation by using l-tryptophan-con-taining standards to simulate the protein background. For example, in GF-AAS, high ... Tris(1,10-phenanthroline)lanthanum(III) Trithiocyanate (KP772).Curr Cancer Drug Targets 9, 59 5–6 07.54 Allard P, Barra AL, Andersson KK, Schmidt PP,Atta M & Gra¨slund A (1996) Characterization ... nrdF+gene was sequenced by a primer walkingapproach. For DNA analysis, dnastar software (DNAS-TAR Inc., Madison, WI, USA) and clone manager 5.0(Scientific & Educational Software, Cary, NC, USA)...
- 14
- 872
- 0
Tài liệu Báo cáo khoa học: Arabidopsis thaliana BTB⁄ POZ-MATH proteins interact with members of the ERF⁄AP2 transcription factor family ppt
... interac- A B347150381203442BTBHTAMBPM1189 1–1 51FRAP2.41150214AP23346012 5–2 51CDBPM1BPM1 1–1 51BPM1 1–1 89GSTGST:RAP2.4 – – – – ++ + – – –+ – – +BPM1T7 inputBPM1 1–1 51BPM1 1–1 89 –+ – +– – + –+ GSTGST:BPM1T7 inputRAP2.4 1–2 51RAP2.4 1–2 51RAP2.4 1–2 95RAP2.4 1–2 95ERAP2.4G179SRAP2.4134–ENDRAP2.4116–ENDRAP2.4125–ENDInputGSTGST:BPM1RAP2.4134–ENDRAP2.4125–ENDRAP2.4InputGSTGST:RAP2.4Fig. ... GATEWAYvectors for Agrobacterium-mediated plant transforma-tion. Trends Plant Sci 7, 19 3–1 95.41 Xiang C, Han P, Lutziger I, Wang K & Oliver DJ(1999) A mini binary vector series for plant transforma-tion. ... protein family inArabidopsis thaliana, and at least one member ismodified in roots during the course of a plant–microbeinteraction. Physiol Plant 124, 15 2–1 66.Arabidopsis thaliana BPM–ERF ⁄ AP2...
- 12
- 657
- 0
Tài liệu Báo cáo khoa học: Mitogen-activated protein kinase phosphatase-1 modulated JNK activation is critical for apoptosis induced by inhibitor of epidermal growth factor receptor-tyrosine kinase pdf
... Lysates were prepared at theindicated time points after the AG1478 addition and analyzed for caspase 3 activity by using a fluorometric substrate-based assay.Each point is the mean of triplicate ... activation of JNK.ERK1 and ERK2, also known as p4 4 and p4 2MAPK, respectively, represent the prototypical MAPKin mammalian cells. ERK MAP kinase catalytic acti-vation was observed in PC-9 ... prepared at the indicated timepoints after the AG1478 addition and analyzed for caspase 3 activ-ity by using a fluorometric substrate-based assay. Each point is themean of the triplicate samples, and...
- 11
- 659
- 0
Tài liệu Báo cáo khoa học: Modulation of sterol homeostasis by the Cdc42p effectors Cla4p and Ste20p in the yeast Saccharomyces cerevisiae pptx
... genetically with ERG4 and NCP1. Fur-thermore, Erg 4p, Ncp 1p and Cbr 1p play important roles in cell polariza-tion during vegetative growth, mating and filamentation. As Ste2 0p andCla 4p are involved ... the importance of sterols for cell polarization, and the interactions between PAKsand proteins catalyzing sterol synthesis and storage, itis tempting to speculate that Ste2 0p and Cla 4p mayinfluence ... fixedwith formaldehyde. (B) Are 1p and Are 2p areinvolved in apical growth. Cells carryingeither pGAL1-CLN1-3HA on a plasmid or theempty vector were treated as described for panel A. The percentage...
- 12
- 699
- 0
Tài liệu Báo cáo khoa học: Emerging pathways in genetic Parkinson’s disease: Potential role of ceramide metabolism in Lewy body disease pptx
... ATPase. Nat Genet38, 118 4–1 191.34 Najim al-Din AS, Wriekat A, Mubaidin A, Dasouki M& Hiari M (1994) Pallido-pyramidal degeneration,supranuclear upgaze paresis and dementia: Kufor–Rakeb ... 26 9–2 81.27 Tamura H, Takahashi T, Ban N, Torisu H, NinomiyaH, Takada G & Inagaki N (2006) Niemann–Pick typeC disease: novel NPC1 mutations and characterizationof the concomitant acid sphingomyelinase ... type C usually appear normal for 1 or2 years with symptoms appearing between 2 and4 years. They gradually develop neurologic abnormali-ties which are initially manifested by ataxia, grand malseizures...
- 7
- 652
- 0
Tài liệu Báo cáo khoa học: Compartmentalization and in vivo insulin-induced translocation of the insulin-signaling inhibitor Grb14 in rat liver pptx
... and polyclonalantibodies against IRb, polyclonal antibodies against EGFand polyclonal antibodies against Grb7 were from SantaCruz Biotechnology (Santa Cruz, CA, USA). Monoclonalantibody against ... from Amersham-Phar-macia (Little Chalfont, UK) and Pierce Biotechnology Inc.(Rockford, IL, USA). WGA–Sepharose 6MB (WGA–Sepharose), protein G–Sepharose, protein A Sepharose andother chemicals ... organelle markers: calnexin (ER);Na+⁄ K+-ATPase (plasma membrane); and EEA1(endosomes).Extraction and immunoprecipitation ofmembrane-associated Grb14 and insulin receptorSubcellular fractions...
- 15
- 497
- 0
Tài liệu Báo cáo khoa học: His374 of wheat endoxylanase inhibitor TAXI-I stabilizes complex formation with glycoside hydrolase family 11 endoxylanases pptx
... Science and Technology, pp. 20 7–2 95. AmericanAssociation of Cereal Chemists: St Paul, Minnesota,USA.3 Coutinho PM & Henrissat B (1999) Carbohydrate-active enzymes: an integrated database approach. ... CCTAGATCTTTACAGGCCGCCGCAACCCGTAAAGXI019 CCGCAACCCGTAAAGGCCGGCAGCCTGXI022 CCGCAACCCGTAAACTTCGGCAGCCTGXI036 GCAGGCTGCCGCAATTTACGGGXI037 CCCGTAAATTGCGGCAGCCTGCK. Fierens et al. Role of TAXI-I ... endoxylanase andTAXI-I, (B) B. subtilis endoxylanase and TAXI-I, and (C) B. subtilis endoxylanase and TAXI[H374Q]. Varying endoxylanase concentrations wereinjected over immobilized TAXI-I (A and...
- 11
- 523
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI