Báo cáo khoa học: Transcriptome proﬁling analysis reveals multiple modulatory effects of Ginkgo biloba extract in the liver of rats on a high-fat diet pdf

... Transcriptome proﬁling analysis reveals multiple modulatory effects of Ginkgo biloba extract in the liver of rats on a high-fat diet Xiaomei Gu1,*, Zuoquan Xie2,*, Qi Wang1,*, Gang ... caused by an HFD. In addition, we found no signiﬁcant alterations in the levels of alanine aminotransferase, aspartate amino-transferase or creatinine kinase in either group H orgroup HG (Table ... Genesinvolved in fatty acid biosynthesis, such as Acacb,Acbd6 (acyl-CoA-binding domain containing 6), Scd2(stearoyl-CoA desaturase 2) or associated genes,Sorbs3 (sorbin and SH3 domain containing...

Báo cáo khoa học: Transcript proﬁling reveals diverse roles of auxin-responsive genes during reproductive development and abiotic stress in rice pdf

... conditions, indicating crosstalk between auxinand abiotic stress signaling.AbbreviationsABA, abscisic acid; ARF, auxin response factor; AuxRE, auxin-responsive element; dap, days after pollination; ... understanding of the molecu-lar mechanisms of auxin signaling pathways. TheseF-box proteins are components of E3 ligase and targetAux ⁄ IAAs, in particular for degradation through the 26S proteasome, ... genes[5–7]. The DNA-binding domains of auxin responsefactors (ARFs) bind to AuxREs of auxin-responsivegenes and regulate their expression [8–10].Keywordsabiotic stress; auxin; microarray analysis; reproductive...

Báo cáo khoa học: "Error Proﬁling: Toward a Model of English Acquisition for Deaf Learners" ppt

... de-scribed, these two processes can proceed on the combination of the data contained in the previousutterances supplied by a given learner and the in- tuitions” granted by information on typical learn-ers, ... undertaken is meant to provide thisstructure by indicating a partial ordering on the acquisition of grammatical features by this popu-lation of learners.1.4 ApplicationsHaving the SLALOM model ... students), thereis signiﬁcant variability in the writing proﬁciency. The impact of this variability is that a particularstring of words may have multiple interpretationsand the most likely one may...

Báo cáo khoa học: Transcript proﬁling during the early development of the maize brace root via Solexa sequencing pot

... derivation of anaccurate measure of gene expression, both individuallyand comprehensively, and the discovery of novelregions of transcription, dramatically changing the way that the functional ... D, Van Montagu M,Inze D & Beeckman T (2004) Transcript proﬁling of early lateral root initiation. Proc Natl Acad Sci USA101, 5146–5151.22 Inukai Y, Sakamoto T, Ueguchi-Tanaka M, Shibata ... provide deeper insight into the regulation of maize brace root development.Materials and methodsPlant material and RNA extraction The maize (Zea mays) inbred line H5468 was used in the present...

Báo cáo khoa học: Expression proﬁling reveals differences in metabolic gene expression between exercise-induced cardiac effects and maladaptive cardiac hypertrophy pot

... maladaptive and adap-tive cardiac hypertrophy.Exercise training increases the functional capacity of the cardiovascular system. The adaptations includeincreases in cardiac mass and dimension, ... Williams SP,Ogasawara A, Shimada B, Williams PM, de Feo G &Paoni NF (2001) Effects of early angiotensin-convertingenzyme inhibition on cardiac gene expression after acutemyocardial infarction. ... remode-ling (biglycan, matrix gla protein, cathepsins, cystatins,integrin a7 and laminin receptor). These genes are con-sistently upregulated in pathological models of cardiachypertrophy indicating...

Báo cáo khoa học: Glycan profiling of urine, amniotic fluid and ascitic fluid from galactosialidosis patients reveals novel oligosaccharides with reducing end hexose and aldohexonic acid residues ppt

... cathep-sin A in galactosialidosis patients, resulting in insufﬁcient protection of b-galactosidase and a- neur-aminidase against excessive intra-lysosomal degrada-tion [2]. Cathepsin A is one of four ... enzymes in a lysosomal multi-enzyme complex comprising N-acetyl-galactosamine-6-sulfate sulfatase, b-galactosidase,cathepsin A and a- neuraminidase [3,4]. The enzyme N-acetylgalactosamine-6-sulfatase ... demonstrating a combined deﬁciency of a- neur-aminidase and b-galactosidase in patient cells.Several activity studies on the structural analysis of sialyloligosaccharides from urine of galactosialidosispatients...

Báo cáo khoa học: Protein aggregation and amyloid ﬁbril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot

... parame-ters are calculated and reported, such as the average a4 v in each hot-spot, the area of the aggregation pro-ﬁle above the HST, the total area (the HST being the zero axis) and the area ... scoring matrix (the valuefor each amino acid at each position is the logarithm of the ratio of its frequency in the training set and the background database). As there is a positive and a negative ... propensities of the 20 natural amino acids (a3 v). Next, calculations are based on the sliding-win-dow averaging technique: a sliding window of a givenlength is chosen and the program calculates the aver-age...

Báo cáo khoa học: Salt-inducible kinase-1 represses cAMP response element-binding protein activity both in the nucleus and in the cytoplasm pdf

... ACTCAAGGGATTGTAGCCTTCCGGCAGCATCTACAGAATCTCGCGAGGACCAAGGGGTTCCTG/5¢-CAGGAACCCCTTGGTCCTCGCGAGATTCTGTAGATGCTGCCGGAAGGCTACAATCCCTTGAGTGAGAGACGTATC and 5¢-GATACGTCCCTTACACAAGGACTTAAGGCATTTAGACAACAGCTTCGGAAGAATGCTAGAACCAAAGGATTTCTG/5¢- CAGAAATCCTTTGGTTCTAGCATTCTTCCGAAGCTGTTGTCTAAATGCCTTAAGTCCTTGTGTAAGGGACGTATC, ... 5¢-GCGAGGACCAAGGGGATTCTGGAGCTGAACAAGGTGCAATTGTTGTACGAACAGGTGTGCCAGTCCTCC/5¢-GGAGGACTGGCACACCTGTTCGTACAATAATTGCACCTTGTTCAGCTCCAGAATCCCCTTTGGCCTCGC and 5 ¢-CTTGCTAGAACCAAAGGATTTCTGGGGTTGAACAAAATAAAAGGGCTGGCTCGGCAAATGGGATCAAACGCAGAC/5¢-GTCTGCGTTTGATCCCATTTGTCGAGC CAGCCCTTTTATTTTGTTCAACCCCAGAAATCCTTTGGTTCTAGCAAG. The ... 5¢-AAAGAATTCCTGTGGCAGGGGACCAGTGG; 708R: 5¢-AAAGAATTCGGGCTGGAGGAGGGGCGTTG; 632R: 5¢-AAAGAATTCCGGGGTGTGGAAGGTACTCA; 572R: 5¢-AAAGAATTCCTCCTGGAAGCTGACAGG; 341R: 5¢-AAAGAATTCGAGCAGGAGGTAGTAAAT; the EcoRI...

Tài liệu Báo cáo khoa học: Time-dependent regulation analysis dissects shifts between metabolic and gene-expression regulation during nitrogen starvation in baker’s yeast doc

... proportionality of the assays. In nearly all cases, the rate was proportionalto the amount of extract for at least two or three dilutionsand only these data points were used for further calcula-tions. ... speciﬁcity of autophagy may depend on the kinetics of uptake by the vacuole and on the sensitivi-ties of proteins to vacuolar proteases [40], which againmay provide an additional layer of regulation. ... glycolysis and may therefore provide an additionallayer of regulation.Second, speciﬁcity of protein degradation is also a plausible mechanism to explain our data. In general,not all proteins are...

Tài liệu Báo cáo khoa học: "Predicate Argument Structure Analysis using Transformation-based Learning" pdf

... Japan{taira,sanae}@cslab.kecl.ntt.co.jp nagata.masaaki@lab.ntt.co.jpAbstractMaintaining high annotation consistency in large corpora is crucial for statisticallearning; however, such work is hard,especially for tasks containing ... Transformation-basedLearningHirotoshi Taira Sanae Fujita Masaaki NagataNTT Communication Science Laboratories2-4, Hikaridai, Seika-cho, Souraku-gun, Kyoto 619-0237, Japan{taira,sanae}@cslab.kecl.ntt.co.jp ... (Kawahara et al., 2002), and the NAISTText Corpus (Iida et al., 2007) in Japanese. The construction of such large corpora is strenu-ous and time-consuming. Additionally, maintain-ing high annotation...

Xem thêm