Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp PCC 6803 ppt

Báo cáo khoa học: Light-induced gene expression of fructose 1,6-bisphosphate aldolase during heterotrophic growth in a cyanobacterium, Synechocystis sp. PCC 6803 ppt

... Fructose 1,6-bisphosphate aldolase (FbaA)18 sTransport and binding proteins slr0559 Periplasmic binding protein of ABCtransporter for natural amino acids (NatB)10 ssll1447 Periplasmic protein, ABC-type ... fbaA were ampliﬁed by PCR, using primers5¢-ATTTCGATCATGCAGGCCG-3¢ and 5¢-GGAAGAACCGTGCATTACC-3¢, and labeled with [a- 32P]dCTP using a Megaprime labeling kit (Amersham Pharmacia, Piscataway,NJ, ... Tanaka A, Asamizu E,Nakamura Y, Miyajima N, Hirosawa M, Sugiura M,Sasamoto S et al. (1996) Sequence analysis of the gen-ome of the unicellular cyanobacterium Synechocystis sp. strain PCC 6803. ...

Báo cáo khoa học: "LANGUAGE SYNTHESIS GENERATION OF GERMAN FROM CONCEPTUAL STRUCTURE: MT PROJECT IN A JAPANESE/GERMAN" pot

... Winograd's terminology for functional gran~nar (Winograd, 1983). In general, case schemata will be mapped into CLAUSE-RS and concept schemata are mapped into NP-R~. A CLAUSE-RS has a ... representation as an interlingua in a practical application will be investigated and demonstrated by translating titles of Japanese papers from the field of "Information Technology". This material ... to ATLAS/II's analysis. In stage i, we first examine those semantic symbols which have an attached case schema and instantiate them according to their trans- formation rules. In this...

Báo cáo khoa học: Cloning and expression of the ﬁrst nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

... gene organization, as well as the same intron phase, as mammalianIL-11 genes. The 204 amino acid trout IL-11 translation has a predictedsignal peptide of 26 amino acids and mature peptide of ... differ-ences in both the 5¢- and 3¢-UTR. The major differ-ences were a 26 bp insertion in the 5¢-UTR of thecDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG(31 ... The two insertions in the 5¢- and 3¢-UTR are underlined and the 13 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR are numbered and distinguished from each other...

Báo cáo khoa học: Differential gene expression proﬁles of red and green forms of Perilla frutescens leading to comprehensive identiﬁcation of anthocyanin biosynthetic genes doc

... (5¢-AGAAAGCTGGGTTTATTTTGGGAGATCCATAACTTTTCTCC-3¢)for the ﬁrst round of PCR; and attB1 (5¢-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3¢) and attB2 (5¢-GGGGACCACTTTGTACAAGAAAGCTGGGT-3¢) for the sec-ond round of PCR. The GATEWAY-compatible ... proanthocyanidins in the Arabidopsis seed coat [14]. Also, the AN9 gene from petunia was incapable of transporting proantho-cyanidin, although it could participate in the transport of anthocyanin [14], ... Nishiyama Y, Hirai MY, Yano M, NakajimaJ, Awazuhara M, Inoue E, Takahashi H, GoodenoweDB, Kitayama M et al. (2005) Functional genomics byintegrated analysis of metabolome and transcriptome of Arabidopsis...

Báo cáo khoa học: VEGF gene expression is regulated post-transcriptionally in macrophages pdf

... Ferrara N (1999) Role of vascular endothelial growth factor in the regulation of angiogenesis. Kidney Int 56,794–814.14 Sawano A, Iwai S, Sakurai Y, Ito M, Shitara K, Naka-hata T & Shibuya ... Strata- gene) of the AUUUA-luc construct.Obtaining RNATotal RNA was obtained using RNeasy (Qiagen). Thequantity and quality of RNA were determined spectropho-tometrically at 260 and 280 nm and ... contains a 30-nt AU-rich sequence with pentamer repeats (5-AUUAUUUAUUUAUUUAUUUAUUUAUUUAUU-3¢). A control repor-ter (AUGUA-luc) was created in which AUGUA pentam-ers replaced AUUUA pentamers...

Báo cáo khoa học: Cloning and expression of a tomato cDNA encoding a methyl jasmonate cleaving esterase pdf

... t heyare capable of mediating a response by regulating gene expression [6,7]. Analysis of Arabidopsis thaliana mutantsimpaired in either JA biosynthe sis or signalling, gave a deeper insight ... application of JA. These experiments demonstrate that individual mem-bers of the jasmonate family are involved – at least in Arabidopsis – in different signalling pathways.An Arabidopsis(jar1)mutantwithadefectinthejasmonate ... ullMJEforMQ (GCA TGCAGGGTGATAAAAATCACTTTGTA) and fullMJErev (AAGGATCCATAATATTTTTGCGAA ATC), adding rest rictio n sites for SphIand BamHI, r espectively. Th e PCR pr oduct w as cloned i ntovector...

Báo cáo khoa học: Silencing the expression of mitochondrial acyl-CoA thioesterase I and acyl-CoA synthetase 4 inhibits hormone-induced steroidogenesis potx

... University of Buenos Aires, ArgentinaSteroid hormones are synthesized in specialized steroido-genic cells in the adrenal gland, ovary, testis, placentaand brain and are essential for maintaining ... our ﬁnding that AA or 22(R)-OH-cholesterol canbypass the effect of siRNA strongly indicate thatACS4 and MTE-I act in the same signaling pathwayat a step before the rate-limiting passage of cholesterolfrom ... step in steroidogenesis [6]. Fatty acyl-CoAs bind to theacyl-CoA-binding protein, which can bind and maythereby activate PBR. This interaction favors theaccumulation of fatty acids near StAR,...

Báo cáo khoa học: Hydrogen independent expression of hupSL genes in Thiocapsa roseopersicina BBS pot

... puriﬁed as a tetramer with an a 2b2structure. This tetramer forms a complex withthe HupT ⁄ HoxJ kinase in vitro [4]. The role of theN-terminal part of the kinase, containing a PASdomain, was ... the inactivation of the chromosomal rpoN gene in the expected way(data not shown). The RPON strain was unable togrow in the absence of ammonium as a nitrogensource indicating that the N2ﬁxing ... with E-value of 5.4e-12) in its C-ter-minal domain. The HupR architecture was determinedusing the SMART database, revealing that T. roseo-persicina HupR contained a response regulator receiverdomain...

Báo cáo khoa học: Differential gene expression in periportal and perivenous mouse hepatocytes potx

... alcohols1.1.1.14sugars4.1.1.32allostericactivation+2.7.1.2 fructose- 1,6-bis-P2.7.1.11oxaloacetateglucose-6-P2.7.1.40citrate2.3.3.8oxaloacetate citrate A 1.1.1.41glutamineammoniaglutamateamino aciddegradationRhbgSlc 1A4 Slc 1A2 6.3.1.2ureacycle2.6.1.13ornithineammoniaDurocanateN-formimino-glutamatehistidineN-methyl-histaminehistamineglutamate2.1.2.54.3.1.34.2.1.492.1.1.8serineglycinepyruvateCexcretionoxaloacetategluconeogenesis4.3.1.171.4.4.24.1.1.324.3.1.19cholesterolcitrateacetyl-CoA1.14.13.17bile ... of histidine catabolism, namely histidine ammonia lyase,urocanate hydratase, glutamate formiminotransferaseand histamine-N-methyltransferase, are preferentiallyexpressed in periportal hepatocytes. ... gluconeogenesis, fattyacid degradation, cholesterol and bile acid metabolism, amino acid degra-dation and ammonia utilization. In addition, several enzymes of phase Iand phase II of xenobiotic...

Báo cáo khoa học: Hypoxia induces expression of a GPI-anchorless splice variant of the prion protein potx

... Kikuchi Y, Kakeya T, Yamazaki T, Takekida K,Nakamura N, Matsuda H, Takatori K, Tanimura A, Tanamoto K & Sawada J (2002) G1-dependent prionprotein expression in human glioblastoma cell lineT98G. ... preseni-lin–2 splice variant in human Alzheimer’s disease braintissue. J Neurochem 72, 2498–2505.29 Matsuzaki S, Manabe T, Katayama T, Nishikawa A, Yanagita T, Okuda H, Yasuda Y, Miyata S, Meshit-suka ... phenotypic anal-ysis of 300 subjects. Ann Neurol 46, 224–233.3 Kikuchi Y, Kakeya T, Sakai A, Takatori K, NakamuraN, Matsuda H, Yamazaki T, Tanamoto K & Sawada J(2004) Propagation of a protease-resistant...

Xem thêm