Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

... CTGCTGTAATAATGGGTAGAAGGARA439 GGAATTCCATATGCGTATTATGGCCAGARA440 TATTTACTCGAGAATCCCCTCCTCAGCARA444 CGGGATCCACCGTGAAAAAGAAAGAATTGTCARA451 GAATTCATAAAGAAGCTTTGTCTGAAGCARA456 CGGCGCGTCATATGGCCAGTCATGATAARA457 ... CGGCGCGTCATATGGCCAGTCATGATAARA457 TGATACGCATATGTCACCGGCTGGCARA458 CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCACARA459 GTGTCACCGGCTGGCATTCTGATTGACTTGGACAAGGATGTAACCAAATTGGCTGAGARA460 CGTGAATTCACCGAGCATGTCACCAAAGCCARA477 ... CGTGAATTCACCGAGCATGTCACCAAAGCCARA477 AATCAGAATGGGATCCGGTGAARA486 CGGCTGACATTCTGATTGACTTGGACGGARA487 CAATCAGAATGTCAGCCGGTGACACAGGARA509 CC AGT CAT GAT A AG CCT GTG TCA CCGARA510 CGG TGA CAC AGG CTT ATC ATG...

Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

... (Ga-napathibhotla and Liu, 2008). Our annotation scheme stands on the following assumptions: (i) the sentence is the unit of analysis, whose interpretation may require the analysis of the ... states were manually annotated. The annotation was per-formed at word and phrase level, and the sentiment expressions identified in the corpus were asso-ciated to the source of the private-state, ... the of comments and the number of votes of each cadidate (Table 1). , in which the number of positive and negative sentences is relatively balanced, all the remaining debates generated...

Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

... UGUUGUUUUAGUGAUCAGAAGGUGY-box family miRNABrd-box: 5´ AGCUUUA |||||||dme-miR-4 3´ AGUUACCAACAGAUCGAAAUAdme-miR-79 3´ UACGAACCAUUAGAUCGAAAUABrd-box family miRNAsK-box: 5´ cUGUGAUa ||||||dme-miR- 2a ... cycleCell survivalmiR-278Site1:Expanded UTR 5´ AAAUGUAAACGAAAA-CCCACCGU ||||| |||||| ||||||| dme-miR-278 3´ UUUGCC UGCUUUCAGGGUGGCUsite2:Expanded UTR 5´ AGAUGGUAAAAUACACGAG CCACUGA ||:||| ... AUGCUAAAUCCGCUUCAGUAUUU ||||||| hsa-miR-200b 3´ AGUAGUAAUGGUCCGUCAUAAUhsa-miR-200c 3´ AGGUAGUAAUGGGCC-GUCAUAAUTGF- s/BMPsR-smadspri-miR-21,19 9a pre-miR-21,19 9a DroshaDGCR8p68SignalMAPKKKERKmiR-21Spry1,...

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

... tubingensis (CAA68128.1), Pgx2 Arabi-dopsis thaliana (AAF21195.1). The mode of action (endo or exo) and the amount of GalpA cleaved off, respectively, are annotated in paren-theses. A question mark indicates ... temperatures.Although bacterial exo-acting polygalacturonasescommonly generate digalacturonate, PelB was shownto liberate monogalacturonic acid as the ﬁrst and onlyproduct on PGA and oligoGalpA. On the basis of ... of pectin areclassiﬁed as members of family 28 of the glycosidehydrolases, including the endopolygalacturonases, exo-polygalacturonases and rhamnogalacturonases [3,4].Although a handful of...

Tài liệu Báo cáo khoa học: Characterization and functional expression of cDNAs encoding thyrotropin-releasing hormone receptor from Xenopus laevis Identiﬁcation of a novel subtype of thyrotropin-releasing hormone receptor ppt

... usingpartially overlapping cDNA fragments and the pair of primers TRHR1-2 sense (5¢-ATAATGGATAACGTAACTTTTGCTG-3¢)/TRHR1-4 antisense (5¢-TCTGTTAAATGTACCTAAGTAGGCA-3¢)andTRHR2-2sense (5¢-CAGCAAAATGGAAAATAGTAGC-3¢)/TRHR2-4 ... (5¢-GATGTCACGCAGAGTGAGCAGGTAG-3¢)/TRHR-7(5¢-GAGACCATACAGAAC-C-3¢); second set, A5 2 (5¢-AGAGTGAGCAGGTAGCGAGAGGAG-3¢)/TRHR-8(5¢-GGGGGTGTAGAGGTTTCTGGAGAC-3¢); thirdset, A5 3 (5¢-CGAGAGGAGCATTAGA-TAGATGCAG-3¢)/TRHR-9 (5¢-GCCGAAATGTTGATGCCCAGATAC-3¢) ... [34]. Rat TRHR2 is also basally more activethan TRHR1, acting via pathways mediated by the transcription factors AP-1, Elk1 and CREB [35].To clarify the functional signiﬁcance of the TRH ligand/receptor...

Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

... 2002 Characterization and regulation of yeast Ca2+-dependentphosphatidylethanolamine-phospholipase D activityXiaoqing Tang, Michal Waksman, Yona Ely and Mordechai LiscovitchDepartment of Biological ... mutants, bearing mutationsat the early and late stages of the secretory pathway, forchanges in PtdEtn-PLD activity at room temperature and at the restrictive temperature of 37 °C(atwhichthetemper-ature-sensitive ... Ca2+ions is biphasic.This pattern raises the possibility that Ca2+may have a dualmechanism of action in activating PtdEtn-PLD, e.g. Ca2+may participate in catalysis as well as facilitate enzyme–substrate...

Báo cáo khoa học: Characterization and cDNA cloning of a cloﬁbrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx

... gradually increased, reaching a peak at the wanderingstage late in the last larval stadium. At the prepupal stage,EH activity declined to a level equal to that in the early time of the stadium. ... the 5¢-end of the ORF and contained a SalIsite(5¢-CTACGTCGACGATGGCGAACATCTGGCCACGAATC-3¢); the reverse primer corres-ponded to the 3¢-end of the ORF and contained an XbaIsite(5¢-AGGCTCTAGATTTATGAGAAATTGGCTTTCTGGAC-3¢).Expression ... clofibrate-treated larvaeusing a QuickPrep Micro mRNA Purification Kit (Amer-sham Pharmacia Biotech), and first-strand cDNA wassynthesized using a First-Strand cDNA Synthesis Kit(Amersham Pharmacia...

Báo cáo khoa học: Function and regulation of ABCA1 – membrane meso-domain organization and reorganization pptx

... 2 (JAK2) and casein kinase (CK2) are involved in the regulation of ABCA1 activity and stability by apoA-I. The inter-action of apoA-I with ABCA1 increases the cellularcAMP content and ABCA1 ... TanakaM, Ota A, Sandoval JC, Nakagawa-Toyama Y, SatoSB, Kobayashi T et al. (2007) Increased lipid rafts and accelerated lipopolysaccharide-induced tumor necrosisfactor alpha secretion in ABCa1-deﬁcient ... lipidtranslocation activity of ABCA1 and that the twoactivities of ABCA1 (apoA-I binding and lipid translo-cation) can be separable (Fig. 3A) . Additionally,W590S mutation retarded the dissociation...

Báo cáo khoa học: Characterization and structural modeling of a new type of thermostable esterase from Thermotoga maritima ppt

... belong to the family of serine hydrolases and share structural and functionalcharacteristics, including a catalytic triad, an a ⁄ b-hydrolase fold and a cofactor independent activity. The catalytic ... FEBSGTCACCTGGTAGTTACTGCCGCCGAAG-3¢,5¢-CGACGATCTCAATAACTTGATGATTTCAGG-3¢ and 5¢-CTCCTGAAATCATCAAGTTATTGAGATCGTCG-3¢, respec-tively (the underlining indicates the modiﬁed codon). Muta-tions ... with the following primers 5¢-GTGCTGGGACACGCCCTCGGTGCGATGC-3¢ and 5¢-GCATCGCACCGAGGGCGTGTCCCAGCAC-3¢,5¢-GATCTTCGGCGGCAGAAACTACCAGGTGACTG-3¢ and 5¢-CAFig. 4. Alignment of the esterase lipase...

Báo cáo khoa học: Signalling and regulation of collagen I synthesis by ET-1 and TGF-b1 doc

... serving as baseline value for the other data,thereby representing the status of both groups of unstimu-lated human primary dermal ﬁbroblasts.Statistical analysisStatistical analysis was performed ... fractions. The ETA-receptor wasenriched in membrane fractions as revealed by twospeciﬁc bands, a predominant band of approximately55 kDa and a less prominent one of approximately45 kDa as described ... tightlycoordinated regulation of synthesis and degradation of extracellular matrix constituents (ECM). This involves a number of different factors including signalling of cytokines in an auto- and paracrine...

Xem thêm