Báo cáo khoa học: Epsilon toxin: a fascinating pore-forming toxin potx

... (1987) Bacterial toxins: lethal amounts. InToxins and Enzymes (Laskin AI & Lechevalier HAeds), pp. 127–135. CRC Press, Cleveland.3 Minami J, Katayama S, Matsushita O, Matsushita C& Okabe ... 499–507.13 Filho EJ, Carvalho AU, Assis RA, Lobato FF,Rachid MA, Carvalho AA, Ferreira PM, NascimentoRA, Fernandes AA, Vidal JE et al. (2009) Clinico-pathologic features of experimental Clostridium ... S, Wada A, Shibasaki S, Annaka M,Higuchi H, Adachi K, Mori N, Ishikawa T, MasudaY, Watanabe H et al. (2009) Spread of a large plasmidcarrying the cpe gene and the tcp locus amongstClostridium...

Báo cáo khoa học: Enzymatic actions of Pasteurella multocida toxin detected by monoclonal antibodies recognizing the deamidated a subunit of the heterotrimeric GTPase Gq potx

... small GTP-binding proteins Rho involved inassembly of actin stress ﬁbers. Proc Natl Acad Sci USA91, 3814–3818.23 Kitadokoro K, Kamitani S, Miyazawa M, Hanajima-Ozawa M, Fukui A, Miyake M & ... (2007)Crystal structures reveal a thiol protease-like catalytictriad in the C-terminal region of Pasteurella multocida toxin. Proc Natl Acad Sci USA 104, 5139–5144.24 Kamitani S, Kitadokoro K, Miyazawa ... diversity: a distinct class of alpha subunits is present in verte-brates and invertebrates. Proc Natl Acad Sci USA 87,9113–9117.30 Akagi T, Shishido T, Murata K & Hanafusa H (2000)v-Crk activates...

Báo cáo khoa học: An ‘Old World’ scorpion b-toxin that recognizes both insect and mammalian sodium channels A possible link towards diversiﬁcation of b-toxins ppt

... quinquestriatus hebraeus was collectedfrom scorpion stings to a parafilm membrane. Sarcophagafalculata (blowfly) larvae and Periplaneta americana (cock-roaches) were bred in the laboratory. Albino laboratoryICR ... Surprisingly, Lqhb1alsocompetes with an anti-mammalian a- toxin on binding to ratbrain NaChs. Analysis of Lqhb1 effects on rat brain andDrosophila Para NaChs expressed in Xenopus oocytesrevealed a shift ... Lqhb1exertstypical b -toxin binding properties to a greater extent thanAahIT4. Lqhb1 and AahIT4 vary also in their effect onblowfly larvae as AahIT4 induces contraction [23] andLqhb1 induces flaccid paralysis.The...

Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

... wereclassified as those causing an increase in patient monitoring, a change in vital signs but without associated harm or a needfor treatment or increased length of stay. Major errors werecategorised ... director, according to anadapted scale [9-11]. Minor errors were classified as thosecausing no harm or an increase in patient monitoring with nochange in vital signs and no harm noted. Moderate ... (GEHealthcare, Anapolis, MD, USA) to the ICU but not on the gen-eral wards. The new system was introduced following a pro-gram of staff training and HWP was completely changed on a single day....

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... substantianigra is a neuropathological hallmark of Parkinson’sdisease. This leads to a decreased level of dopamine inthe striatum. As a result, synaptic transmission is nega-tively affected ... jbc.M110.177246.24 Doi H, Okamura K, Bauer PO, Furukawa Y, ShimizuH, Kurosawa M, Machida Y, Miyazaki H, Mitsui K,Kuroiwa Y et al. (2008) RNA-binding protein TLS is a major nuclear aggregate-interacting protein ... presenceof both amorphous aggregates and ﬁbrillar deposits.Fig. 5. Aggregation of a- synuclein after 240 h. Samples containingMPTP (A and C) and MPP+(B and D) were analysed by SDS ⁄ PAGE (A and B)...

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... sequencingand mutational analysis of a gene cluster involved innitrite reduction in Paracoccus denitriﬁcans. AntonieLeeuwenhoek 66, 111–127.13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997)Gene ... FEBS23 Chang CK (1994) Heme d1and other heme cofactorsfrom bacteria. Ciba Found Symp 180, 228–238.24 Van Spanning RJ, Wancell CW, De Boer T, HazelaarMJ, Anazawa H, Harms N, Oltmann LF & ... total cell lysate and theperiplasmic fraction, but was absent from the membrane and cytoplasmic fractions. (B) The same cell fractions as shown in (A) when sub-jected to SDS ⁄ PAGE analysis and...

Tài liệu Báo cáo khoa học: Steﬁn A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

... red).Table 1. Average distances between CA atoms of the stefins andcatalytic residues of cysteine proteases.Distance calculated d (A ˚)Papain–stefin B 23.93Cathepsin H–stefin A 23.36 ± 0.23Cathepsin ... Biochemistry andMolecular and Structural Biology, JozefStefan Institute, Jamova 39, SI-1000Ljubljana, SloveniaFax: +386 1 477 3984Tel: +386 1 477 3215E-mail: dusan.turk@ijs.siDatabaseThe coordinates ... theP1 data set is a consequence of highly anisotropic diffrac-tion, which forced us to discard part of the collected datato maintain reasonable merging statistics. The anisotropywas a consequence...

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in ﬁssion yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 in ﬁssion yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y ... GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y...

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... followed by PCR with Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned into ... 5¢-AAGCTTCCGGAGGCTGCTAGAGAC-3¢ and 5¢-GGATCCAAGAACTGTGTATGTCTG-3¢. The 1.6-kbp full-length Skn cDNA, whose termination codon was changedto a BamHI site, was inserted between the SalI and ... respectively.C25S and C19 9A mutations of Shh were introduced byPCR using primers 5¢-CCTGCAGCAGCGGCAGGCAAGGTTATATAG-3¢ and 5¢-GGGCCCAGAGGCCAGGCCGGGGCACACCAG-3¢, and primers 5¢-GGCATGCTGGCTCGCCTGGCTGTGGAAGCA-3¢...

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTCGAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCAGGGG-3¢ for the latter. The ... organ-speciﬁc blood vascular and lymphaticendothelial cells of the mouseTakashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki Yoshida and Hirotake ... LEC, lymphatic endothelial cell; Lyve-1, lymphatic vesselendothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA,paraformaldehyde;...

Xem thêm