PEOPLE AND WORK IN EVENTS AND CONVENTIONS: A Research Perspective
PEOPLE AND WORK IN EVENTS AND CONVENTIONS: A Research Perspective
... South Africa. She has published in the area of tourism planning and management, appearing in Anatolia and Journal of Human Resources in Hospitality and Tourism. She is also a board member of ATLAS-Africa. ... range of subjects in leading international tourism and hospitality journals and presented her research at international and national conferences. Her two major areas of research interest are ... Management at the University of South Australia. She holds a doctorate and a master’s degree in business administration and professional qualifi cations of the Hotel, Catering and Institutional Management...
- 247
- 441
- 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
... in nature to a data manager which fails to freedata, but is easier to detect and prevent.• Data manager changes data. A malicious data manager may change the value of its data on each cacherefresh. ... more data than requested. The Mach kernel can only handle integralmultiples of the system page size in any one call and partial pages are discarded.Since the data manager may have external constraints ... threads to handle data requests also aids in deadlock prevention; one thread within a task may service a data request for another thread in that task.• Server tasks which cannot tolerate changing...
- 23
- 1,290
- 1
A contrastive analysis of metaphorical lexis and collocation in english and vietnamese economics discourse
... howhuman beings interact in an economy is beginning to be questioned, and insteadconcepts associated with evolutionary biology are starting to be promoted amongcertain leading academics. Perhaps ... heavily in improving their English language skills on top of theirmain academic and research duties; in practice this means that specialisttranslation services as well as ESP teaching are in great ... conceptual level – a failure to assimilate the new to the alreadyexisting. Many of today’s standard meaning of words and expressions began as metaphors, and their utility has made them conventional....
- 33
- 1,109
- 3
An investigation into syntactic and semantic features of idioms denoting work in english and vietnamese
... contrastive analysis and to classify them in accordance with their semantic and syntactic feature. 3) Finding and making a comparison and contrast between structural mechanisms then semantic ... and Vietnamese- have been collected and treated differently at various times. We have collected and analyzed data in order to find out the differences and similarities in syntactic and semantic ... the contrastive research, we aim to find out the similarities and differences in syntax, semantics and cultural features of idioms in two languages. In addition, statistical and observation methods...
- 13
- 1,933
- 4
A study on syntactic and pragmatic features of asking and answering in english and vietnamese job interviews
... a grammatical unit that is an arbitrary union of a sound and a meaning and that cannot be further analysed”. From this definition, we can state that elements that have a semantic or grammatical ... and classifying EWGH and VWGT as single words and WG, analyzing the data to find out the syntactic and semantic features of EWGH and VWGT, comparing and contrasting to discover similaries and ... following ways; - Pragmatic and stylistic features of EWGH and VWGT. - EWGH and VWGT in the combination with other human body organs such as “heart and mind, heart and soul, head and heart” in...
- 13
- 897
- 0
A study of modality expressed in terms of grammaticalization and lexicalization in english and vietnamese
... grammaticalization and lexicalization denoting modality in English and Vietnamese? 2. What are the similarities and differences between English and Vietnamese in terms of grammaticalization and lexicalization ... ways of analizing modality, as follows: a. Lexicalization Grammaticalization + Lexical meanings of modal verbs Distinction of grammatical + Modal adjectives categories of Mood, Tense, and ... conventionalized on the level of the lexicon’’ 2.2.5.Grammaticalization and Lexicalization in Combination According to Lehmann (1995) [57], “lexicalization and grammaticalization are processes that...
- 23
- 1,131
- 3
A cross cultural study of giving compliments and responses in english and vietnamese
... “Communication is,rather, the successful interpretation by an addressee of a speaker’s intent in performing a linguistics act” (Georgia M. Green, Natural Language Understanding,p.1). And “” ... gratitude goes to Mr. Tinh(M .A) who teaches at ASEM Vietnam center for his essential materials and advice. Last but not least, I give a very special thanks to my family and classmates, who always ... the traditional method of learning and teaching language, which focuses on rote memorization of grammatical and lexical components of language. The fact has proved that, it is not suitable in thedevelopment...
- 15
- 4,986
- 70
A study into words, idioms denoting 'richness' and 'poorness' in enghish and their vietnamese equivalents
... the same categorical meaning. They do not share all the grammatical features. Thus, all the lexemes sharing categorical meaning do not have all the grammatical meanings.1.3.2. Lexical meaning ... consists and partly by it grammatical meaning.According to Nguyen Thi Van Lam (2002:16), “all lexemes with full word-forms have a grammatical, more particularly a categorical, meaning.”For example, ... phrases and sentences of language have meanings”. In this section, word-meaning is focused. There are two types of meaning: grammatical and lexical meaning. We shall deal with two types in...
- 64
- 1,014
- 5
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... tgccaccgct gagcaataac 320 321 tagcataccc cttggggcct ctaaacgggt cttgaggggt 360 361 TTTTTGCTGA AAGGAGGAAC TATATCCGGA TATCCCGCAA 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT ... cttaaggtatactcgccgtcgcgtaccgccgcacacgggcttt gaattccatatgagcggcagcgatggcggcgtgtgcccgaaa M S G S D G G V C P K taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg ... 161 gaaaaaatgc cgccgcgata gcgattgccc gggcgcgtca 200 201 tttgccgcgg caacggctat tgcggctaac tcgagcccgg 240 241 gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct...
- 9
- 497
- 0
Từ khóa: a structure found in numerous proteases and implicated in protein bindingcoordinating and regulating signaling events in regulatory networksliars and saviors in a sentiment annotated corpustraining and development in business and industrya closer look at methods and classes in javaBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)