Báo cáo Y học: Proteasome-driven turnover of tryptophan hydroxylase is triggered by phosphorylation in RBL2H3 cells, a serotonin producing mast cell line pptx
Báo cáo Y học: Proteasome-driven turnover of tryptophan hydroxylase is triggered by phosphorylation in RBL2H3 cells, a serotonin producing mast cell line pptx
... Proteasome-driven turnover of tryptophan hydroxylase is triggered by phosphorylation in RBL2H3 cells, a serotonin producing mast cell line Yoshiko Iida1, Keiko Sawabe1, Masayo Kojima1, ... Rapid turnover of tryptophan hydroxylase is driven by proteasomes in RBL2H3 cells, a serotonin producing mast cell line. J. Biochem. (Tokyo) 127, 121–127.24. Nakayama, K. & Nakayama, K. (2001) ... 261,734–739.21. Hasegawa, H., Kojima, M., Iida, Y. , Oguro, K. & Nakanishi, N.(1996) Stimulation of tryptophan hydroxylase production in a serotonin producing cell line (RBL2H3) by intracellular calciummobilizing...
- 9
- 404
- 0
Báo cáo khoa học: Autocatalytic processing of procathepsin B is triggered by proenzyme activity doc
... clarified.Procathepsin B was shown by zymography to hydrolyze the synthetic sub-strate 7-N-benzyloxycarbonyl-l-arginyl-l-arginylamide-4-methylcoumarin(Z-Arg-Arg-NH-MEC), suggesting that procathepsin B is ... cathepsins.ResultsProcathepsin B is active on a smallsynthetic substrate In a previous study, a low catalytic activity against thesubstrate 7-N-benzyloxycarbonyl-l-arginyl-l-arginyla-mide-4-methylcoumarin ... University of California, San Francisco,CA, USA4 Department of Pathology, Stanford University School of Medicine, CA, USACysteine cathepsins comprise a group of papain-likecysteine proteases...
- 9
- 425
- 0
Báo cáo y học: " Transcriptome analysis of murine thymocytes reveals age-associated changes in thymic gene expression"
... 4.53 3.3 TTCATCCGTCACAGGAGTCA AGGAATTCGGAGCAGAGAC A chemokine (C-X-C motif) receptor 6 (Cxcr6) NM_030712 Cxcr6 2.49 7.91 3.98 4.7* AACAGCCAGGAGAACAAACG GGGCAAGTTCAGCAGAAACAdecorin (Dcn) ... the ingenuity data analysis program (www.ingenuity.com) using our uploaded data. ALL CHANGES AT ALL AGES CANONICAL PATHWAYS NUMBER of GENES p VALUE Oxidative Phosphorylation 18 0.001 T Cell ... was cell- to -cell signaling and interaction, which could play a key role in thymocyte survival or death associated with age. Many genes associated with cancer are also affected in aging thymocytes....
- 14
- 464
- 0
Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot
... the protein in mammalian cells. In orderto facilitate the proteins’ purification, a recombinant versionwas made containing a C-terminal myc tag followed by a His6sequence, by cloning the CCR5 ... protein was unidentifiable by autoradiography in cell lysates, but appeared as the predominant band afterpurification, although a background of contamination by other proteins was still present. ... plasmamembrane was quantified by FACS analysis using the 2D7antibody (Fig. 2B). It was found that the 60–70% of themyc-his tagged protein was internalized, as much as forwild-type CCR5 in...
- 12
- 541
- 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx
... allophycocyanins and phycocyanins,HPLC separation allowed a quantitative estimation of therelative amount of each protein component from the areaunderlying each peak. This was facilitated by the fact ... bands having completelydisappeared. HPLC analysis of the second sucrose bands of UV-B treated phycobilisome revealed that the b-phycocy-anin peak at 214 nm (indicated with an arrow) was missingfrom ... specific damage to variations in aromaticamino-acid content, because the amino-acid composition of allophycocyanins and phycocyanins is significantly con-served, it seems reasonable to attribute...
- 9
- 477
- 0
Báo cáo Y học: Differential regulation of the Fe-hydrogenase during anaerobic adaptation in the green alga Chlamydomonas reinhardtii pot
... reinhardtiiThomas Happe and Annette KaminskiBotanisches Institut der Universita¨t Bonn, GermanyChlamydomonas reinhardtii, a unicellular green alga, co n-tains a hydrogenase enzyme, which is induced by ... ORFencoding a protein with an apparent molecular mass of 53.1 kDa. The t ranscription of the hydrogenase gene is very rapidly induced during anaerobic adaptation of thecells. The deduced amino-acid ... library.This gene bank was constructed with poly (A) +RNAfrom anaerobically adapted C. reinhardtii cells. T he differ-ential regulation of protein biosynthesis dur ing a naerobicadaptation is...
- 11
- 469
- 0
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
... possibleNACA 5 Acute vital (life threatening) dangerNACA 6 Acute cardiac or respiratory arrestNACA 7 DeathZakariassen et al. Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2010, ... score was in the analyses cate-gorised as NACA 0-1, indicating a patient either withno symptoms/injuries or in no need of medical treat-ment, NACA 2-3, indicating need of medical helpwhere value ... whitepaper emphasised this as an important challenge for thecapacity and organization of the health care system in Norway [18]. In the US, the rate of ambulance useamong older patients (65 years or...
- 9
- 784
- 0
Báo cáo y học: "The epidemiology of intensive care unit-acquired hyponatraemia and hypernatraemia in medical-surgical intensive care unit"
... University of Calgary, Calgary, AB T2N 2T9, Canada3Department of Medicine, University of Calgary, Calgary, AB T2N 2T9, Canada4Alberta Kidney Disease Network, Calgary, AB T2N 2T9, Canada5Calgary ... epidemiology of sodium disturbances in a population of Table 2Multivariable analyses of patient characteristics*Acquire hyponatraemia Acquire hypernatraemiaCharacteristic Odds ratio (95% CI) P Value ... vary according to patient characteris-tics. Finally, ICU-acquired hyponatraemia and hypernatraemiaare associated with increased in- hospital mortality. Studies areneeded to establish optimal...
- 8
- 721
- 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... Research Paper The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey Adalet Altunsoy1, Cenk Aypak2, Alpay Azap1, ... Department of Family Medicine, Ankara University, School of Medicine, Ibni Sina Hospital 06100, Ankara, Turkey 3. Department of Clinical Microbiology and Infectious Disease, Marmara University, ... cost and resistance patterns of leading nosocomial pathogens. Materials and Methods Hospital setting and antibiotic policy: NARP was initiated in Turkey in February 2003 by a central regulation...
- 6
- 692
- 0
Báo cáo y học: "Surgical Treatment of Depressed Scar: A Simple Technique"
... General Hospital, Bari, Italy 3. Department of “Head and Neck Diseases”, Hospital “Fatebenefratelli”, Rome, Italy 4. Department of Maxillofacial Surgery, Calabrodental, Crotone, Italy 5. Department ... healing of soft tissues after a trauma. However, ab-normal or disturbed collagen production can cause anomalies of the cutaneous surface and textural ir-regularities. A cosmetically acceptable ... acceptable scar is often at the level with the surrounding skin, a good color match, soft, and narrow. Favorable lines of closure are usually within or parallel to relaxed skin tension lines: lines...
- 3
- 449
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ