Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx
... Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer Lello Zolla, Maria Bianchetti and Sara RinalducciDipartimento ... thatadaptation of cyanobacterial phycobilisomes to light by complementary chromatic adaptation is a complex processthat changes the ratio of phycocyanin to phycoerythrin inrods of certain phycobilisomes ... four allophycocyanins and phycocyanins,HPLC separation allowed a quantitative estimation of the relative amount of each protein component from the areaunderlying each peak. This was facilitated...
- 9
- 477
- 0
Báo cáo Y học: Functional reconstitution of the HIV receptors CCR5 and CD4 in liposomes pot
... associated with the cells wasanalysed by FACS.RESULTS Functional expression of a Myc-his tagged version of CCR5, and a his-tagged version of CD4Because the post-translational modifications of ... eluted with imidazole. The protein was unidentifiable by autoradiography in celllysates, but appeared as the predominant band afterpurification, although a background of contamination by other ... lipidconcentrations and do not give quantitative information on the concentration of detergent present in the membrane. Asexpression of proteins in mammalian cells leads to the isolation of lg rather...
- 12
- 541
- 0
Báo cáo Y học: Functional analysis of the rat bile salt export pump gene promoter Regulation by bile acids, drugs and endogenous compounds potx
... served as a template. Anantisense (5¢-CACTGTTTGCTTATATTTCAATGGAATAAAGTCCAGCTCTAGC-3¢; exchanged bases in bold)and sense (5¢-GCTAGAGCTGGACTTTATTCCATTGAAATA-TAAGCAAACAGTG-3¢) oligonucleotide of the ... membranes.As substrates, such as b-estradiol and rifampin inhibit Bseppromoter activity they are capable of causing cholestasis by the reduction of canalicular bile acid transport capacity. Incontrast ... express the human liver organic anion transporting polypeptideOATP -A (previously called OATP) in their plasma mem-brane they are capable of taking up taurin-conjugated bileacids [29] that can bind...
- 9
- 556
- 0
Báo cáo Y học: NMR structure of the HIV-1 regulatory protein Vpr in H2O/trifluoroethanol Comparison with the Vpr N-terminal (1–51) and C-terminal (52–96) domains pot
... a semipreparative Vydac C18column using a linear gradient of acetonitrile. An experimental mass of 11 431.92 Da wasobtained by electrospray mass spectroscopy and a mass of 11 433.02 Da was calculated ... Tyr50 cH Thr552.6H Tyr50 a 1Gly563.5H Tyr50 a 1Gly562.6H Tyr50 a 2Gly563.5H Tyr50 a 2Gly562.6H Tyr50 a Ala593.5H Tyr50 a Ala592.6H Tyr50 b Ala593.5H Tyr50 b Ala59b1Tyr50 a 1Gly56b2Tyr50 ... stabilized by the hydrogen bond NH54–CO52.NMR relaxation The NMR relaxation data were collected for the 22 labeledamino acids in order to analyse the backbone internalmotions and to study the structure...
- 10
- 475
- 0
Tài liệu Báo cáo Y học: Molecular modeling of the dimeric structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain docx
... LPL monoclo-nal antibody against human LPL purified from postheparinplasma. One of the monoclonal antibodies, has an epitopesimilar to that of the 5D2 monoclonal antibody andwas conjugated with ... detected at the same position as the high- affinity peak of wild-type LPL. The LPL in the eluate wasdetected by Western blot with LPL polyclonal antibody7640. The fraction number of the high- affinity ... hydrogen,modification of bonds, potentials of forcefield, and fixation of heavy atom, backbone, and Ca, were performed formolecular mechanics calculations. and then the energyminimization of the...
- 10
- 679
- 0
Tài liệu Báo cáo khoa học: Functional studies of active-site mutants from Drosophila melanogaster deoxyribonucleoside kinase Investigations of the putative catalytic glutamate–arginine pair and of residues responsible for substrate specificity docx
... R105H-fwd:5¢-GCTAAAAATAATGGAGCACTCCATTTTTAGCGCTCGC-3¢ . R105H-rev:5¢-GCGAGCGCTAAAAATGGAGTGCTCCATTATTTTTAGC-3¢. R105K-fwd:5¢-GCTAAAAATAATGGAGAAATCCATTTTTAGCGCTCGC-3¢. R105K-rev:5¢-GCGAGCGCTAAAAATGGATTTCTCCATTATTTTTAGC-3¢Sequence ... whereas catalytic activity wasaltered because the kcatvalue had decreased dramatic-ally. The structural study showed that the backboneconformation of the enzyme was unchanged. Because the ... Y7 0W-fwd:5¢-CTGCTGGAGCTGATGTGGAAAGATCCCAAGAAG-3¢. Y7 0W-rev :5¢-CTTCTTGGGATCTTTCCACATCAGCTCCAGCAG-3¢. Q81N-fwd:5¢-TGGGCCATGCCCTTTAACAGTTATGTCACGCTG-3¢. Q81N-rev:5¢-CAGCGTGACATAACTGTTAAAGGGCATGGCCCA-3¢....
- 10
- 504
- 0
Báo cáo Y học: Functional expression of human liver cytosolic b-glucosidase in Pichia pastoris Insights into its role in the metabolism of dietary glucosides ppt
... [1,2].b-Glucosidases h ydrolyse O-glycosidic bonds at the t ermi-nal, nonreducing end of carbohydrates with retention of anomeric con®guration. They are widely present in naturewhere they demonstrate catalytic ... ietary xenobiotics than f or other aryl-glycosides. Thesedata indicate that human CBG hydrolyses a broad range of dietary glucosides a nd may play a critical role in xenobioticmetabolism.Keywords: ... a- L-arabinopyranoside,b-L-arabinopyranoside, a- L-arabino-furanoside, a- D-man-nopyranoside, a- D-mannopyranoside, a- D-fucopyranoside, a- D-xylopyranoside, a- L-rhamnopyranoside) w as deter-mined u sing the...
- 10
- 775
- 0
Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot
... CATGTTGCTGTAGCAGTTTGATPO-SR ATATAAGCTTATCCTCTGATAGCAK LF GACCCATCATCGAGGACTAAK SF ACCACAAGGGTTTCAAGCAGAK LR CCACACCAGGAAGGTCTTGTAK SR GGTGGAGGAAACCTTGGACTeIF 4A LF ACGTCAACATGTCCGACAAAeIF 4A SF CGGTGGAGACAACAAGGACTeIF 4A ... TGCTACAGCAACTGGTGATCAGAAGGGLR1 CCCTTCCTGATCACCATGTTGCTGTLR2 GGCCATCATACAGGTGACTAGGAGGGTLR3 GGGTGATTTGACACACGGTTTTGATGGAPWF1 ATGGGATATGTTCTCAGTCHH-SF ACAGATTTACGACTCCTCCTGES-SR CATGTTGCTGTAGCAGTTTGATPO-SR ... P & Spanings-Pierrot C(2006) The crustacean hyperglycemic hormones from aneuryhaline crab Pachygrapsus marmoratus and a freshwater crab Potamon ibericum: eyestalk and pericardialisoforms....
- 12
- 474
- 0
Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf
... 5¢-TGCAGAGTTCcAtATGGTTGATCAAG-3¢Antisense 5¢-CGAAAAAAGGAGGAAGAAGCAATGC-3¢aac2 (A. t.) Sense 5¢-TGTAGAGGTTcAtATGGTTGAACAGACTC-3¢Antisense 5¢-CTTAATGACTGCGGGATTTGGTGGTAC-3¢aac3 (A. t.) Sense 5¢-CTGATTTGTACAAcAtATGGATGGATC-3¢Antisense ... was synthesizedenzymatically from [a- 32P]ATP (NEN, Bad Homburg,Germany), as described by Tjaden et al.[13],andthepurity of the [a- 32P]ADP preparation was confirmed by a thin-layer chromatography ... Sense 5¢-CTGATTTGTACAAcAtATGGATGGATC-3¢Antisense 5¢-GGGCTATTCTTTCATCATCCTCATCG-3¢aac1 (S.t.) Sense 5¢-TTAAACGTTcatATGGCAGATATGAACC-3¢Antisense 5¢-GGAAGTTACGAGGCTGACTTAGGC-3¢aac1 (R.n.) Sense...
- 10
- 486
- 0
Báo cáo Y học: Kinetic studies of human tyrosyl-DNA phosphodiesterase, an enzyme in the topoisomerase I DNA repair pathway pot
... replication machinery. Accumulation of double-stranded DNA breaks above a threshold, ultimately couldcause cell death [2].Camptothecin, a plant alkaloid originally isolated by Wani & Wall ... DNA with the forward primer,5¢-GCTGGATCCCTCCCGAGAAACAAATTTCAATGG-3¢, and the reverse primer, 5¢-TCGGGATCCATTTACTAGTCGTTCTCATGACGAGCAAGG-3¢. The amplifiedDNA fragments were digested with BamHI ... Similarly, oligonucleotides of 5¢-AAGTATAACTCTCGAGCCCTCCACATCAAGG-3¢ and 5¢-GGAGGGCACCCACATGTTCCCATGC-3¢ were used asprimers to generate the huTDPND174 variant.Generation of expression constructs...
- 8
- 503
- 0
Từ khóa: Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Chuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ