Báo cáo khoa học: Two conserved domains in regulatory B subunits mediate binding to the A subunit of protein phosphatase 2A pdf
Báo cáo khoa học: Two conserved domains in regulatory B subunits mediate binding to the A subunit of protein phosphatase 2A pdf
... ops alter the binding of the B and C subunits [13]. The B subunits bind to repeats 1±10 of the A subunit, whereas the C s ubunitbinds to repeats 11±15. Interactions between the B and C subunits ... loopsabrogates the binding of some B subunits but not others[13,28]. The results here de®ne two < /b> distinct PP 2A binding domains < /b> in < /b> the B subunits that are signi®cantly conserved< /b> among all B subunits of the ... separatePP 2A b inding domains < /b> in < /b> the regulatory < /b> a nd targeting B 5 6a subunit, which a re conserved < /b> in < /b> sequence a nd function in < /b> allthree families of regulatory < /b> B subunits. This ®nding mayfacilitate...
- 7
- 550
- 0
Báo cáo khoa học: Two CYP17 genes in the South African Angora goat (Capra hircus) – the identification of three genotypes that differ in copy number and steroidogenic output pptx
... are two < /b> alleles of the same gene (Fig. 3).These data reveal the novel finding that, in < /b> both the South African Angora goat and the Boer goat, CYP17ACS) and ACS+ are not two < /b> alleles of a singleCYP17 ... probablyoriginated from two < /b> of the subspecies that were used in < /b> the breeding of the Boer goat, probably throughnonhomologous recombination, although it remains to be determined whether both ... (antisense)GAGGCAGAGGTCACAGTAATCYP17 sensorprobeTTCTGAGCAAGGAAATTCTGTTAGAC-FLCYP17 anchorprobe640-TATTCCCTGCGCTGAAGGTGAGGA-pReal-time 3bHSDLP (sense)CTGCAAGTTCTCCAGAGTCReal-time 3bHSDRP...
- 10
- 548
- 0
Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx
... catalysis the E376 sidechain swingstowards the Ca atom of the substrate, in < /b> order to abstract the proton [17]. It seems likely that the fixedcharge of the guanidino group of R256 stabilizes the catalytic ... for the inactivity of the R256Tmutant protein. Thermostability of the purified mutant proteins The effect of temperature on MCAD stability wasdirectly investigated by incubating aliquots of eachpurified ... at 450 nm, the ratio A 450 A 280gives a roughindication of the amount of FAD bound to the puri-fied protein (assuming no major change in < /b> the extinc-tion coefficient of the bound cofactor in...
- 9
- 533
- 0
Báo cáo khoa học: Two overlapping antiparallel genes encoding the iron regulator DmdR1 and the Adm proteins control sidephore and antibiotic biosynthesis in Streptomyces coelicolor A3(2) pdf
... production, i.e. the Adm protein appears to act as a negative regulator of the biosynthesis of undecylprodigiosin. The oppositebehaviour of TAadm and TAdmdR1 strains regardingproduction of antibiotic ... (Roche).Antibodies against Adm, DmdR1 and DmdR2Antibodies against DmdR1 and DmdR2 were obtained asdescribed previously [15]. Antibodies against a 15 aminoacid peptide of the C-terminal region of Adm ... growth in < /b> some media. The Adm protein may serve as an activator of desferrioxamine synthesis,and the DmdR1 ⁄ Adm ‘tandem’ proteins may act as a fine modulator system of iron regulation. As indicatedabove,...
- 14
- 435
- 0
Báo cáo khoa học: Two functionally redundant isoforms of Drosophila melanogaster eukaryotic initiation factor 4B are involved in cap-dependent translation, cell survival, and proliferation doc
... to scan to the initiation codon. eIF4G is a scaffold/adaptor protein whichbinds to the cap -binding protein e IF4E, as w ell as t o eIF 4A and to further factors such as poly (A) -binding protein (PABP) ... cap-dependent translationas shown in < /b> Fig. 4A. Whereas the addition of BSA to the Fig. 3. Dm-eIF 4B- L and Dm-eIF 4B- S are RNA -binding proteins. (A) Filter -binding assay showing the titration curves of Drosophila ... forhuman the eIF 4B RRM domain [53]. T he RNA -binding activity of Dm-eIF 4B was confirmed by cross-linking to the radiolabeled 5¢-UTR of Dro sophila Ultrabithorax andcaudal mRNA. As shown in < /b> Figs 3B and...
- 14
- 366
- 0
Báo cáo khoa học: Two short protein domains are responsible for the nuclear localization of the mouse spermine oxidase l isoform pdf
... 5¢-CGAAGTTGGTCGG-3¢ and rpS7-reverse5¢-GGGAATTCAAAATTAACATCC-3¢; b- actin controlspecific primer pairs: b- actin-forward 5¢-TGTTACCAACTGGGACGACA-3¢ and b- actin-reverse 5¢-AAGGAAGGCTGGAAAAGAGC-3¢. Three separate ... FEBSproteins, based on the 3D structure of maize poly-amine oxidase (MPAO), indicated that this region islocalized on the tip of the FAD -binding domain, in< /b> close spatial proximity to the protein ... protein region encodedby exon VIa of the mSMOl isoform. This observationhas led us to hypothesize that these two < /b> protein domains,< /b> named nuclear domain A and nucleardomain B (NDA and NDB, respectively),...
- 8
- 413
- 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... already available [26]. We were able to obtainone T-DNA insertion line each for AtRPA7 0a andAtRPA7 0b (Fig. 1A) . The T-DNA insertion in< /b> AtRPA7 0a (atrpa7 0a) was lethal, but the AtRPA7 0b T-DNA ... (AGAATTCTGAGGTTGAAGAAGCTAGTAA) primers, and 7 0b F2 (TACTATCAGCAGAAGCAATGTGGTGATA) and 7 0b R2(TTACTGAGATGTCTTGTTCTTGGAAATGT) primersfor atrpa7 0b. As a control, A. thaliana putative 40S ribo-somal protein ... such as ionizing radiation, UV,and camptothecin [18–21]. The RPA phosphorylationstimulated by DNA damage promotes DNA binding and chromatin association of ATR (ataxia telangiecta-sia-mutated and...
- 12
- 588
- 0
Báo cáo khoa học: "Multilingual Text Processing in a Two-Byte Code" pdf
... By assigning the same basic code to variations of a single letter (as a, _~, A, A~ , all variants will automatically be alphabetized the ~ame way, which is as it should be. The choice of variant ... European alphabets. They keep a constant f~rm, combining freely with any consonant letter. Alphabets of India and Southeast Asia place vowels above, below, to right or to left of a consonant letter ... needed, by a Program which has a dictions~y listing all wu~Is containing matary t_h. Spatial arrangement of printe~ characters. In < /b> al~habets of Europe, letters (and information units) almost always...
- 4
- 322
- 0
Báo cáo khoa học: "TWO TYPES OF PLANNING IN LANGUAGE GENERATION" pot
... HOVY@VAXA.ISI.EDU Abstract As our understanding of natural language gener- ation has increased, a number of tasks have been separated from realization and put together un- der the heading atext planning ... make the hearer feel socially~ subordinate, and yet to be relatively informal These goals play as large a role in < /b> generation as the speaker's goal to inform the hearer about the topic. ... it allows the separation of planning and re- alization tasks, enabling them to be handled in < /b> appropriate terms. (In < /b> fact, it even allows the separation of special-purpose planning tasks with...
- 8
- 433
- 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... collection of the data in < /b> and of itself as the basis for taking relevant actionat the farm. They may skip the process of systematic anal-ysis of data and give advice based on their immediate eval-uation ... treat-ment and potential links to data quality. This understand-ing provides insight into potential errors (bias andrandom error) related to data based on clinical examina-Acta Veterinaria ... phenomena; 'scoring andrecording data on metritis' that relate to the quality of the data that are produced. We analyse and build &apos ;a model of understanding' based on DBL's...
- 10
- 587
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015