Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

... 0foreach peptide. The percentage of degradation was calculated by comparing the area of the peaks of the intact peptide att ¼ 0andt ¼ 60 min.Binding assaysBinding assays were carried out at ... 943expressed as Kifor NK-1M (major site) and NK-1m (minorsite), and EC50values for the cAMP pathway and for the inositol phosphates pathway.SP, [Ala9]SP and [Pro9]SP are almost equipotent at ... of the peptide. Thus, SP was used as a model peptide to analyse the structural and biological consequences of a single b-amino acid incorporation. When Phe7 or Phe8 are replaced by b2-HPhe, the...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... catalyzes the transfer of a hypoxanthine or guanine base to a- d-5-phosphoribosyl 1-pyrophosphate (PRPP), pro-ducing IMP or GMP and pyrophosphate. Several of the identified mutations leading to disease ... bonded to mainchain and side chain atoms of amino acids 145–149(Fig. 1C). A second Ca2+ion is coordinated by the side chain of Asp201, a phosphate ion and five water molecules. The phosphate involved ... initial step for elucidatingwhich compounds could stabilize the protein. The increased DTaggfor IMP, GMP, hypoxanthine ⁄ PRPP and guanine ⁄ PRPP indicated a similar binding profile asfor HPRT....

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: electron transfer through the nitric oxide synthase ﬂavoprotein domain pdf

... comparison, the NOS flavoprotein domain isrelated to a family of dual-flavin enzymes that containFAD and FMN, and transfer NADPH-derived elec-trons to separate hemeprotein partners or to attachedheme ... and a C-terminal flavopro-tein or reductase domain that binds NADPH, FAD and FMN. The two domains are separated by a CaM-binding motif. During catalysis, NADPH-derived electrons transfer into the ... heme-dioxy species by a bound H4B cofactor rather than by the flavoprotein domain [16]. The H4B radical is thenreduced within the enzyme by the flavoprotein domain in order to continue catalysis...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: probes of hydrogen tunnelling pptx

... characteristic p- p charge transfer(CT) absorbance and NAD (P) H binding and dissocia-tion can be measured by following the formation of thisCT absorbance at, for example, 555 nm while perform-ing ... (wt) and N18 9A mutant of MR withNADH. The wt trace is ﬁt to a single exponential and the N18 9A trace to a 4-exponential function – see the main text for moredetails. (Inset) The same data on a ... sub-strate may be required; typical NAD (P) H saturationconstants for OYEs are 0.1-1 mm and as an example, a typical measurement, by stopped-ﬂow, of the temper-ature dependence of the 1° KIE of an...

Tài liệu Báo cáo khoa học: Structural and mechanistic aspects of ﬂavoproteins: photosynthetic electron transfer from photosystem I to NADP+ doc

... protein–ﬂavin complexes and tailor the midpoint potentials in these proteins, aswell as many details of the binding and electron transfer to protein and ligand partners, have been revealed. In addition ... subunits of Synechococ-cus elongatus (Sy) PSI, PsaC, PsaD and PsaE, and the extrinsic loop of PsaA, present a positively chargedsurface potential (Fig. 1A) and are proposed to partici-pate in electrostatic ... highlydependent on the approach and colinear orientation of the N5 of the ﬂavin, the hydride to be transferred, and C4 of the nicotinamide. In FNR, displacement of the C-terminal Tyr appears to be...

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... a nondomain-swapped dimeric form. Domain swappingis avoided in Pa SurE by a sharp turn in the segment of residues 242–245, bringing the polypeptide chainback to the same subunit. We analyzed the interactions of ... pH on the phosphatase activity of St SurE using pNPP as the substrate. (D) Effect of divalent cations on the phosphatase activity of St SurE using pNPP as the substrate.Table 2. Comparison of ... templateusing Deep Vent DNA polymerase (New England Biolabs,Ipswich, MA, USA), a sense primer (CATATGGCTAGCATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCGTGCCAACTCCCAC)...

Tài liệu Báo cáo khoa học: Structural and functional investigations of Ureaplasma parvum UMP kinase – a potential antibacterial drug target ppt

... with ADP and UDP, and ADP showed a rate that was > 20 times that of UDP. In order to determine the true Kmfor UMP and ATP, a two-substrate assay was performed at four concentrations of UMP and ... from the opportunistic pathogen Ureaplasma parvum was deter-mined and showed similar three-dimensional fold as other bacterial and archaeal UMPKs that all belong to the amino acid kinase family. ... parvumwas enzymatically characterized, particular with regard to the substrates UMP and ATP, the inhibitor UTP and the potential activator GTP. The crystal structurewas determined by X-ray crystallography...

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... fiber protein. The penton contains all necessary components for viral attachment and entry into the host cell. After initial attachment via the head domain of the fiber protein, the penton base interacts ... formed by insertions between the strands of the jellyroll domain (Fig. 3). Antiparallelb-sheets made up of strands CHEF and BIDG packagainst each other, forming the jellyroll topology, a typical ... minifiber protein, PB is the pen-ton base, P* is the initial penton, and P is the pentonafter conformational change. The stability of the com-plex results from the effect of the crystallographicallyobserved...

Tài liệu Báo cáo khoa học: Structural and functional speciﬁcities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family docx

... Gesualdo L, Grandaliano G, Maiorano E &Schena FP (2001) The role of alpha-smooth muscleactin and platelet-derived growth factor-beta receptor in the progression of renal damage in human IgAnephropathy. ... kinasereceptors PDGF receptor -a and -b. These two recep-tor isoforms dimerize upon binding the PDGFdimer, leading to three possible receptor combina-tions, namely -aa,-bb and -ab. The extracellularregion ... fourPDGFs are inactive in their monomeric forms. Theyshare the same receptors; the PDGF receptor -a and -b.These receptors dimerize when the dimeric PDGFbinds. The receptors may combine to generate...

Tài liệu Báo cáo khoa học: Temperature and phosphate effects on allosteric phenomena of phosphofructokinase from a hibernating ground squirrel (Spermophilus lateralis) pptx

... and urea became more potent inhibitors at low temperature. Whiletypically considered an activator of PFK activity, inorganic phosphate per-formed as an inhibitor at 5 °C. Decreasing temperature ... Assay temperature was manipulated by using the microplate thermal controller for 37 °C assays or by placing the entire microplate reader into a low temperature incuba-tor for 5 °C studies; in ... comparedwith 2.13 at 5 °C. The addition of phosphate at 37 °Cproduced the typical effects of an activator on ATPkinetics; 10 mm phosphate lowered the KmforMg.ATP by 58% and increased the...

Xem thêm