Báo cáo khoa học: "Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals" pdf

Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf

... LinguisticsLiars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates Paula Carvalho Luís Sarmento University of Lisbon Labs Sapo UP & University of Porto Faculty of ... where a multiplicity of sentiments for a variety of topics and corresponding targets are potentially involved (Riloff and Wiebe., 2003; Sarmento et al., 2009). Alternative approaches to automatic ... targets (Ga-napathibhotla and Liu, 2008). Our annotation scheme stands on the following assumptions: (i) the sentence is the unit of analysis, whose interpretation may require the analysis of the...

Báo cáo khoa học: Structural and thermodynamic insights into the binding mode of ﬁve novel inhibitors of lumazine synthase from Mycobacterium tuberculosis pptx

... withhydrophobic character: Pro51, Val53, Leu69, Leu156 and Ala158. Whereas four arginines (Arg19, Arg71,Arg154 and Arg157), two histidines (His73 and His159), two aspartates (Asp50 and Asp74) and Glu68form ... precession imagesgenerated with the program pattern [32]. The X-ray datawere evaluated and scaled with the programs denzo and scalepack [31]. Statistics of the data collection are given inTable 1. ... for-mation of hydrogen bonds between oxygen atoms of its hydroxyl groups with the main chain nitrogen and main and side-chain oxygen atoms of Ala59 and Glu61 of one subunit and with the main chain...

Tài liệu Báo cáo khoa học: Fish and molluscan metallothioneins A structural and functional comparison ppt

... weadded a BamHI site upstream from the ATG codon, usingthe 5¢-end primer (5¢-CTACTACGAATTAGGATCCCCTGCACCTTG-3¢) and the 3¢-end primer (5¢-GTAATACGACTCACTATAGGGCGAATTGGG-3¢). Amplification wasperformed ... counterparts.Oxidative and metal bridge polymerizationAfter chromatographic purification and enzymaticremoval of the glutathione S-transferase (GST) tail,proteins were analyzed by SDS ⁄ PAGE (15% gel). Asexpected, ... Theabsorbance decrease at 254 nm was reported as a fraction of thestandard absorbance (absorbance at room temperature) in order tocompare the denaturation profile of the Cd–thiolate chromophore of the two...

Tài liệu Báo cáo khoa học: "Word Order in German: A Formal Dependency Grammar Using a Topological Hierarchy" pptx

... (1959) and numerous analyses that have since corrobo-rated his analysis, we assume that the relativepronoun plays a double syntactic role:• On one hand, it has a pronominal role inthe relative ... grammar, the parameters to instantiateare the vocabulary V, the set of (lexical) cate-gories C, the set of syntactic relations R, the set of box names B, the set of field names F, theinitial ... sentences of German.2.2 Topological modelThe internal structure of a domain is a se-quence of fields. For example, the main do-main is the underlying pattern of a declarativesentence, and it...

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-speciﬁc blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTCGAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCAGGGG-3¢ for the latter. The ... isolation and long-termculture of organ-speciﬁc blood vascular and lymphaticendothelial cells of the mouseTakashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki ... toexamine the endothelial cell biology of the mouse, and will accelerate the molecular and cellular analysis of ECs and their heterogeneity in various vascular beds.The early mortality of the...

Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

... complexthan in T cells, with several peaks of nuclease hyper-sensitivity [85]. Mast cells express GATA-2 as well asNFAT and AP-1, and GATA-2 initiates the formation of an additional discrete GATA-2 ... typically recruitHATs such as SAGA and NuA3, which mainly acety-late histone H3, and NuA4 which acetylates histone H4on K5, K8 and K12. This cascade of events leads torecruitment of transcription ... [139,140].JADE1 also has an additional PHD domain that inter-acts with non-methylated histone H3, meaning that itcan direct recruitment of HBO1 both in advance of and in the wake of a transcribing...

Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

... UGUUGUUUUAGUGAUCAGAAGGUGY-box family miRNABrd-box: 5´ AGCUUUA |||||||dme-miR-4 3´ AGUUACCAACAGAUCGAAAUAdme-miR-79 3´ UACGAACCAUUAGAUCGAAAUABrd-box family miRNAsK-box: 5´ cUGUGAUa ||||||dme-miR- 2a ... cycleCell survivalmiR-278Site1:Expanded UTR 5´ AAAUGUAAACGAAAA-CCCACCGU ||||| |||||| ||||||| dme-miR-278 3´ UUUGCC UGCUUUCAGGGUGGCUsite2:Expanded UTR 5´ AGAUGGUAAAAUACACGAG CCACUGA ||:||| ... AUGCUAAAUCCGCUUCAGUAUUU ||||||| hsa-miR-200b 3´ AGUAGUAAUGGUCCGUCAUAAUhsa-miR-200c 3´ AGGUAGUAAUGGGCC-GUCAUAAUTGF- s/BMPsR-smadspri-miR-21,19 9a pre-miR-21,19 9a DroshaDGCR8p68SignalMAPKKKERKmiR-21Spry1,...

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... Functional and structural analyses of N-acylsulfonamide-linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan1, Bryan D. Smith2,*, Ronald T. Raines2,3 and K. Ravi Acharya11 Department ... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-bindingproteins.DatabaseStructural data for the two RNase A complexes are available in the Protein Data Bank ... USAIntroductionUpon catalyzing the cleavage of RNA, RNases operateat the crossroads of transcription and translation.Bovine pancreatic RNase A (EC 3.1.27.5) is the bestcharacterized RNase. A notoriously stable...

Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

... GCATCAACTTTCAAAAGATF127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAGR144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATACI152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCATN154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGTK31 1A ... AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTTY55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACTT56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG CAGCAAGCACATAATCCATGTCAAACCCAAAACACTRegulation ... AGAATGTAAAATCTTTCAGTK31 1A CGCGCTGAAAATTGGTAC CCAGTTTTAGTATCCACCG319D GGACCCCTTACAGCA GTGTAGGTACCAATTTTCD39 6A GGCTATTTTCTTGGCTGA AAGCTCTGAAGCTCTTCM436W GTGGATGGGGAGCCTG CCGTAGCACATGTCCAH428D AAGAAAGTAACTGACGACATGGACATGTG...

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... Canyuk B, Focia PJ & Eakin AE (2001) The role foran invariant aspartic acid in hypoxanthine phospho-ribosyltransferases is examined using saturation muta-genesis, functional analysis, and ... ﬁlter paper assay and tritium-labeledsubstrates. Experiments have been repeated three to four times and the data are given as the mean ± SD. kcatwas calculated usingMw(HPRT) = 27132 Da and ... speciﬁcity of PRTFDC1 wasfurther characterized using a radiochemical assay withtritium-labeled bases as substrates, whereas the struc-tural basis for substrate recognition and activity wasrevealed...

Xem thêm