Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx
Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx
... label of the parent and of ancestors with a different category, as in the case of VP/S-NOM in the example.2.1 Task representation and evaluation methodTo formulate the task as a machine-learnable ... Shallow parsing on the basis of words only: A case studyAntal van den Bosch and Sabine BuchholzILK / Computational Linguistics and AITilburg UniversityTilburg, The NetherlandsAntal.vdnBosch,S.Buchholz ... the value is either the function for the head of a chunk, or the dummyvalue NOFUNC for all non-heads. For creating the POS-based task, all words are replaced by the gold-standard POS tags associated...
- 8
- 657
- 0
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
... whereas that for melibioseand a- Me-Gal, as anomers of lactose and b-Me-Gal,was in the intermediate exchange regime. Thus, the configuration at the hemiacetal carbon of galactosemay affect the ... Cross-peaks are labeled based on ananalysis of through-bond connectivities. The side chains of NH2resonances of aspara-gines and glutamines are connected byhorizontal lines. The side chains of ... during titration ([sugar] ⁄[EW29Ch] = 0.5–3) and the resonance signal of the side-chain NH of Trp33 disappeared. The broadenedsignals sharpened at the position of the second signalat [sugar] ⁄...
- 11
- 458
- 0
Báo cáo khoa học: "Corpus Effects on the Evaluation of Automated Transliteration Systems" docx
... held at least a Bachelors de-gree. Table 1 summarizes the information about the transliterators and their perception of the giventask. Participants were asked to scale the difficulty of the transliteration ... Persian translit-eration systems on a variety of controlled corporausing evaluation metrics that appear in previoustransliteration studies. Varying the evaluation cor-pus in a controlled fashion ... and prior lan-guage knowledge of human transliteratorsused to construct the corpora, and the origin of the source words that make up the cor-pora. We find that the word accuracy of au-tomated...
- 8
- 433
- 0
Báo cáo khoa học: Preliminary Report on the Insertion of English Articles in RussianEnglish MT Output"" pdf
... Corporation Research on a non-statistical scheme for the insertion of English articles in machine-translated Russian is described. Ideal article insertion as a goal is challenged as unreasonable. ... considerations, or use a combined syntactico- statistical method; the aim of all such routines is the selection of one and only one of the four articles (a, an, the, Ø). None of the solutions ... listed and each was classified intuitively as a member of one of the five article-pattern classes. Once again the first half of the corpus was tested, and again no unacceptable results were obtained....
- 3
- 423
- 0
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf
... 2 in the mito-chondrial membranes of all of the deletion mutants suggestthat these can be assembled as a subcomplex in the mito-chondrial membrane, independent of the presence of anyother ... Electro-phoretic analysis of DNA on agarose gels, restrictionendonuclease analysis, ligation of DNA fragments,Table 1. Yeast strains used in this study.Strain Genotype ReferenceW303–1 A (WT) MATa, ade2–1, ... (SUY106 -a) grew on nonfermentable medium, although at a reduced rate compared to the wild-type strain. In the case of the VZ9 strain, this was to be expected, based on the reduced growth rate of the...
- 10
- 517
- 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... Ca2+-dependentmanner almost as effectively as intact Akazara scallop troponin. Therefore,Akazara scallop troponin regulates the contraction through the activatingmechanisms that involve the region spanning ... in the absence of divalent cation. Therefore,this interaction potentially participates in both the Ca2+-dependent activation of the contraction and the maintenance of structural integrity of ... of Akazara scalloptroponins dramatically decreased (Fig. 6D), suggestingthat Akazara scallop troponin does not function at the temperature appropriate for vertebrate troponins.DiscussionThe...
- 12
- 514
- 0
Báo cáo khoa học: "An experiment on the upper bound of interjudge agreement: the case of tagging" docx
... descriptive grammar by Quirk et al. (1985), also that work was made available to them, as well as a number of modern English dictionaries. The training was based on the disambiguation of ten smallish ... patents ('Pat'); one contained excerpts from the law of Cali- fornia; one was a medical text ('Med'). None of them had been used in the development of the ENGCG grammatical ... The disambiguated text was then au- tomatically compared to another version of the same extract that was disambiguated by an expert on ENGCG. The ENGCG expert then discussed the analytic...
- 5
- 353
- 0
Báo cáo khoa học: "Incremental Parsing with the Perceptron Algorithm" potx
... the parser will depend on the definition of partial analyses, of ADV and FILTER,and of the representation Φ. The next section describesour instantiation of these choices.3 A full description ... incorporated into a partial analysis for the previous words. For any partial analysis there willbe a set of potential attachment sites: in the example, the attachment sites are under the NP or the ... kept training data; section 24 was held-out devel-opment data; and section 23 was for evaluation. Aftereach pass over the training data, the averaged perceptronmodel was scored on the development...
- 8
- 418
- 0
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf
... 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUAACAAUGUGAAAGCAAUGUGAUA 5′3′UAAAUGUGAAUACUAAGAGUAAGCAAUGUGAUAIL6R mRNA mut 1 ... in about252 1A BC 5′3′ 5′ 3′ 5′ 5′3′3′UAUAAGAGUAUCCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ 5′ 3′ 5′ 5′3′CCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUACCUUUAGGGACCGUUACACUA3′ ... 0.05).25215′3′5′3′5′3′5′CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA3′UAAAUGUGAAUACAAUGUGAAAGCAAUGUGAUAIL6R mRNAmiR-2 3a 253120 A B18161412**10EGFP intensity86420EGFPEGFP-IL6R...
- 9
- 541
- 0
Tài liệu Báo cáo khoa học: Marine toxins and the cytoskeleton: pectenotoxins, unusual macrolides that disrupt actin pptx
... chemotherapy agents and actin cytoskeleton dynamics with potentialclinical applications.AbbreviationsF-actin, filamentous actin; G-actin, globular actin; OA, okadaic acid; PTX, pectenotoxin; SA, ... nucle-ation. On the basis of models of the actin filament,PTX binding would disrupt key lateral contactsbetween the PTX-bound actin monomer and the lowerlateral actin monomer within the filament, ... supports the idea that lactone ring integrity is essential for the action of PTXs; oxidation on C43 decrease the toxic-ity of the molecule, and oxidation on C34 does notaffect the potency of PTXs.Unusual...
- 7
- 507
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Chuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ