Báo cáo khoa học: "Transonics: A Practical Speech-to-Speech Translator for English-Farsi Medical Dialogues" docx
Báo cáo khoa học: KCTD5, a putative substrate adaptor for cullin3 ubiquitin ligases docx
... 12CA5 mAb against HA was from Roche(Indianapolis, IN, USA), anti-HA clone HA.11 was fromCovance (Berkely, CA, USA), anti-glutathione S-transferase(GST) and mAb against myc (9E10) were from Santa ... The Authors Journal compilation ª 2008 FEBSKCTD5, a putative substrate adaptor for cullin3ubiquitin ligasesYolanda Bayo´n1, Antonio G. Trinidad1, Marı a L. de la Puerta1, Marı a del ... Program of Signal Transduction, Burnham Institute for Medical Research, La Jolla, CA, USA3 Structural Bioinformatics Group, Centro Nacional de Investigaciones Oncolo´gicas, Madrid, Spain4...
- 11
- 402
- 0
Tài liệu Báo cáo khoa học: "Collecting a Why-question corpus for development and evaluation of an automatic QA-system" pdf
... excess of information. FAQ-pages tend to alsoanswer questions which are not asked, and also con-tain practical examples. Human-powered answersoften contain unrelated information and discourse-like ... each paid reward.• Qualifications To improve the data quality, a HIT can also be attached to certain tests,“qualifications” that are either system-providedor created by the requester. An example ... framework provided addi-tional information for each assignment, for examplethe time workers spent on the task. We believe thisinformation can be used to analyse and use our databetter, and...
- 9
- 610
- 1
Tài liệu Báo cáo khoa học: "GEMINI: A NATURAL LANGUAGE SYSTEM FOR SPOKEN-LANGUAGE UNDERSTANDING*" doc
... that when they are formulated loosely, as in the pre- vious paragraph, they appear to conflict. In par- ticular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a ... Grammatical Relations, MIT Press, Cambridge. Carbonell, J., and Hayes, P. (1983). "Recovery Strategies for Parsing Extragrammatical Lan- guage", American Journal of Computational ... overhead asso- ciated with adding types to the grammar. The major grammatical category plays a spe- cial role in the typing scheme of Gemini. For each category, Gemini makes a set of declarations...
- 8
- 376
- 0
Tài liệu Báo cáo khoa học: "Creating a Multilingual Collocation Dictionary from Large Text Corpora" docx
... length-based and integrates a shal-low content analysis. It begins by individuating a paragraph in the target text which is a first candi-date as target paragraph, and which we call"pivot". ... corpora are available, also thetranslation equivalents of the collocation contextare displayed, thus allowing the user to see how a given collocation was translated in different lan-guages, and ... two kinds of tests on the paragraphsin this span: a test of paragraph content, and a testof paragraphs relative size matching. The first testcompares the paragraphs' numbering (if present).The...
- 4
- 479
- 0
Tài liệu Báo cáo khoa học: "WebCAGe – A Web-Harvested Corpus Annotated with GermaNet Senses" docx
... perfor-mance of WSD algorithms for languages such asEnglish for which hand-crafted sense-annotatedcorpora have been available (Agirre et al., 2007;Erk and Strapparava, 2012; Mihalcea et al., ... amount of data that canreasonably be annotated by hand.Leacock et al. (1998), Agirre and Lopez de La-calle (2004), and Mihalcea and Moldovan (1999)propose a set of methods for automatic harvestingof ... be language inde-pendent and should be applicable to as manylanguages as possible for which the neces-sary input resources are available.(2) The quality of the automatically generateddata...
- 10
- 419
- 0
Tài liệu Báo cáo khoa học: "TOWARDS A DICTIONARY SUPPORT ENVIRONMENT FOR REAL TIME PARSING" potx
... especially on grammatical theory - for example, Generalised Phrase Structure Grammar' (GPSG) (Gazdar et al., In Press), Lexical Functional Grammar (LFG) (Kaplan & Bresnan, 1982) - and ... systems for the syntactic analysis of substantial fragments of natural language. These developments also demonstrate that if natural language processing systems are to be able to handle the grammatical ... information to link a new word sense to domain knowledge already encoded in the knowledge base of a limited domain natural language application such as a database query system. Given a hand-coded...
- 8
- 393
- 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... Tsubouchi H, Naka D, Takahashi K,Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy-ama O, Takahashi K et al. (1989) Molecular cloningand sequence analysis of cDNA for human hepatocytegrowth factor. ... Yokohama, Japan2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, JapanIntroductionType II transmembrane serine proteases (TTSPs) arestructurally ... sets: 5¢-TCCCATCTGTAGCAGCAACT-3¢ and 5 ¢-GGATTTTCTGAATCGCACCT-3¢ for TMPRSS13 (34 cycles), and 5¢-ATGGAGGCTGCTTGGGCAACA-3¢ and 5¢-ACAGGCAGCCTCGTCGGAGG-3¢ for HAI-1 (26 cycles). The GAPDH-specific...
- 13
- 641
- 0
Tài liệu Báo cáo khoa học: Erythrochelin – a hydroxamate-type siderophore predicted from the genome of Saccharopolyspora erythraea docx
... from bacterial genomics. Nat Prod Rep24, 1073–1109.32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H,Naganawa H, Hamada M & Takeuchi T (1985) For- oxymithine, a new inhibitor of angiotensin-convertingenzyme, ... (Hartmann Analytic, Braunschweig, Germany) wasadded. The supernatants were extracted with XAD16 resinafter an additional 2 days of growth. The dried eluate wasdissolved in 10% methanol and analyzed ... 447–453.19 Oliveira PH, Batagov A, Ward J, Baganz F & KrabbenP (2006) Identification of erythrobactin, a hydroxamate-type siderophore produced by Saccharopolyspora eryth-raea. Lett Appl Microbiol...
- 14
- 614
- 0
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... AGCTGATCTTCGAAGATCTTCGAAGATMutated HSEsenseBiotin-TCGACTTCAAGCTTGTACAAGCTTGTAGMutated HSEantisenseAGCTGAAGTTCGAACATGTTCGAACATC‘Scrambled’oligonucleotideBiotin-AACGACGGTCGCTCCGCCTGGCT140406080100120Counts ... TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analysesKristiina A. Vuori1, Johanna K. Ahlskog2, Lea Sistonen2and Mikko Nikinmaa11 Centre ... hAutoradiographyAdd D beads and incubateD A O2Read AlphaLISA signal at 615 nmHSEFig. 1. Comparison of EMSA and TransLISA for the detection of HSF1–DNA binding activity. (A) Schematic presentation...
- 9
- 457
- 0
Tài liệu Báo cáo khoa học: Interferon-a induces sensitization of cells to inhibition of protein synthesis by tumour necrosis factor-related apoptosis-inducing ligand ppt
... Shigeno M, Nako K, Ichikawa T, Suzuki K, Kawakami A, Abiru S, Miyazoe S, Nakagawa Y, Ishikawa H,Hamasaki K et al. (2003) Interferon -a sensitizes humanhepatoma cells to TRAIL-induced apoptosis ... 40760–40767.34 Yamada H, Tada-Oikawa S, Uchida A & Kawanishi S(1999) TRAIL causes cleavage of bid by caspase-8 andloss of mitochondrial membrane potential resulting inapoptosis in BJAB cells. ... Monoclonal antibody against PARP (C2-10)was obtained from Trevigen (Gaithersburg, MD, USA).Antibodies against 4E-BP1 and a- tubulin were obtainedfrom Santa Cruz Biotechnology (Santa Cruz, CA, USA)and...
- 11
- 679
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI