Báo cáo khoa học: "Chinese Segmentation with a Word-Based Perceptron Algorithm" docx

Tài liệu Báo cáo khoa học: Identiﬁcation of a novel matrix protein contained in a protein aggregate associated with collagen in ﬁsh otoliths pdf

... M, Hasegawa K, HoritaC & Akera S (1999) A new matrix protein familyrelated to the nacreous layer formation of Pinctadafucata. FEBS Lett 462, 225–229.5 Kono M, Hayashi N & Samata T ... region wasdecreased and a new band was detected at 64 kDa, butonly after treatment with heparitinase II (Fig. 5A) .Although the same band was obtained after digestionFig. 3.45Ca overlay analysis ... has three crystal phases: calcite, ara-gonite and vaterite. Although calcite is the most stablecrystal thermodynamically, many organisms can formmetastable aragonite crystals with desired morphologiesunder...

Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

... orÔhemoabzymesÕ, are not as efﬁcient a category of catalysts astheir natural hemoprotein counterparts. The hemoabzymes,which display a peroxidase activity, are characterized bykcat/Kmvalues ... hydroperoxide, following a peroxidase-like two-step oxygen-transfer mechanisminvolving a radical–cation intermediate. The best system,associating H2O2as oxidant and 3A3 –MP8 as a catalyst, inthe presence ... mass spectrometry.Preparation of monoclonal antibodiesMP8 was covalently attached to keyhole limpet hemo-cyanin (KLH) and to BSA, using glutaraldehyde as a coupling agent, in 1Mbicarbonate...

Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc

... WEHD-AMC; caspase 2, VDVAD-AMC; caspase 3, DEVD-AMC; caspase 4, WEHD-AMC; caspase 5,WEHD-AMC, caspase 6, VEID-AMC; caspase 7, DEVD-AMC; ca-spase 8, IETD-AMC; caspase 9, LEHD-AMC; caspase 10, ... units.Caspases and inhibitorsCaspase substrates and their inhibitors were purchased fromBiomol. Ac-DEVD-AMC is a substrate for caspases 3and 7; Ac-YVAD-AMC is a substrate for caspase 1;Ac-IETD-AMC ... caspases, termed paracaspase, was identiﬁedin Homo sapiens using a PSI-BLASTsearch [39]. Paracaspasecould be a candidate gene for KIPase although no caspaseactivity from its product has...

Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt

... 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAGReverse ompA105 5¢-GCCATGAATATCTCCAACGAGReverse ompA117 5¢-CATCCAAAATACGCCATGAATATCForward 5¢rpsO 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCGReverse 5¢rpsO 5¢-GCTTCAGTACTTAGAGACForward ... 5¢-GCTTCAGTACTTAGAGACForward 3¢rpsO 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACCReverse 3¢rpsO 5¢-GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(T)18 5¢-T(18)GAAAAAAGGGGCCACTCAGGForward rpsO internal 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTGReverse ... 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTGReverse 3¢rpsO-(C)18 5¢-C(18)GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(G)18 5¢-G(18)GAAAAAAGGGGCCACTCAGGReverse 3¢rpsO-(N)18 5¢-GAATTGCTGCCGTCAGCTTGAForward oxyS109* 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTTReverse...

Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

... TAT ATG T Weak 3 aa2 ⁄ 4 55067 TCA ATG C Weak 58 aa3 33 39% 609296093360939GTA ATG CTGC ATG TTCC ATG GGAdequateWeakAdequate13 aa33 aa31 aa3¢ 76 49% –4¢ 56 61% 61041 GGA ATG T Adequate ... [13].PositionKozak consensus A GCC ATG GGContextATG1330 AAG ATG A AdequateATG2345 CTG ATG T WeakATG3396 CCC ATG A WeakATG4489 CTG ATG A WeakHu-K4 A. Munck et al.1722 FEBS Journal 272 (2005) ... obviousretrieval signal is missing.The human phospholipases D1 and D2 are mainlyassociated with the plasma membrane or with themembranes of intracellular organelles although theylack a transmembrane...

Tài liệu Báo cáo khoa học: "Unsupervised Segmentation of Chinese Text by Use of Branching Entropy" pdf

... Proceedings of the COLING/ACL 2006 Main Conference Poster Sessions, pages 428–435,Sydney, July 2006.c2006 Association for Computational Linguistics428 0.5 1 1.5 2 2.5 ... 0.75 0.8 0.85 0.9 0.95 1recallprecisionBincreaseBordinaryBmax433 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 10 100 1000 10000 100000 1e+06size(KB)recallprecision434...

Tài liệu Báo cáo khoa học: "Chinese Word Segmentation without Using Lexicon and Hand-crafted Training Data" pdf

... grouping character pairs with high value of mutual information into words. Although this strategy is very simple and has many limitations(e.g., it can only treat bi-character words), the characteristic ... absolute measure). Its drawback is it attaches to a character rather than to the location between two adjacent characters. This may cause some inconvenience if we want to unify it with mi. ... Word Segmentation without Using Lexicon and Hand-crafted Training Data Sun Maosong, Shen Dayang*, Benjamin K Tsou** State Key Laboratory of Intelligent Technology and Systems, Tsinghua University,...

Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt

... Hyb-24DNY with the class A b-lactamase revealed that Asn266 of Hyb-24DNY has a similar spatial position to that of Glu166 in theclass A b-lactamase (Fig. S3). In the class A b-lactam-ase (Protein Data ... potentially possesses an advantage for biotechnological applications.X-ray crystallographic analyses of the G181D ⁄ H266N ⁄ D370Y enzyme andthe inactive S11 2A- mutant–Ald complex revealed that Ald ... of a nylon-6 byproduct-degradingenzyme from a carboxylesterase with a b-lactamase foldYasuyuki Kawashima1,*, Taku Ohki1,*, Naoki Shibata2,3,*, Yoshiki Higuchi2,3, Yoshiaki Wakitani1,Yusuke...

Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the speciﬁc motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

... EMSAFluorescence quenchingResult Average Kd(nM)AAAGACATG + + 0.25 A GAGACATG ND –AAGGACATG ND –AAATACATG ––AAAGCCATG ––AAAGAGATG + + 1.5AAAGACCTG ND –AAAGACACG ND + 4AAAGACAT A ... Coralville, IA, USA). In addition, oligo-nucleotides, namely A GAGACATG (P2), AAGGACATG(P3), AAATACATG (P4), AAAGCCATG (P5), AAAGAGATG (P6), AAAGACCTG (P7), AAAGACACG(P8), and AAAGACAT A ... that A BCshifted123123456bandProbe1.00E+008AAAGAGATGAAGGACATGAAAGACCTGAAAGACATGKd=1.2 nMAAAGAGATGKd=0.29 nMAAAGACACGKd=4 nMAAAGACACGAAAGACATAAGAGACATGAAAGACATGAAAGCCATGAAATACATG8.00E+0076.00E+0074.00E+0072.00E+0070.00E+000141612108Fluoriscence340Fluoriscence340640.00...

Báo cáo khoa học: "Multilingual WSD with Just a Few Lines of Code: the BabelNet API" pdf

... or are automatictranslations (WNTR / WIKITR) – and about theirlanguage and lemma. In addition, translation rela-tions among lexical items are represented as a map-ping from source to target ... (bn:02945246n) and ETH-ICAL BANKING (bn:02854884n, from Italian).3 An API for multilingual WSDBabelNet API. BabelNet can be effectively ac-cessed and automatically embedded within applica-tions by means ... sentencesinto many languages (Navigli and Ponzetto, 2010;Lefever et al., 2011; Banea and Mihalcea, 2011),as well as the projection of monolingual knowledgeonto another language (Khapra et al., 2011).In...

Xem thêm