Báo cáo khoa học: Exo-mode of action of cellobiohydrolase Cel48C from Paenibacillus sp BP-23 A unique type of cellulase among Bacillales ppt

Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc

... (CCAAACCACGTTTACTCACCTCAGCAGCCAATACCG) for KR mutation; RKDmsAF (GCTGCTGAGGTGAGTCGCAAAGGTTTGGTAAAAACG) and RKD-msAR (CGTTTTTACCAAACCTTTGCGACTCACCTCAGCAGC) for RK mutation; and KRtoKKDmsAF(GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACGACAGCG) ... KRtoKKDmsAF(GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACGACAGCG) and KRtoKKDmsAR (CGCTGTCGTTTTTACCAAACCCTTTTTACTCACCTCAGC) for KKmutation.SDS/PAGE and western blottingProteins were separated using SDS ⁄ PAGE and ... (GGCCGAATTCACCATTATGAGCACTTTTA) and PCR_Ami- A_ EcoRI_rev (GGCCGAATTCGCTGTGTCCGTTGCTGGTT) for AmiA, and PCR_MdoD_EcoRI_for (GGCCGAATTCACCATTATGGATCGTAGAC) and PCR_Mdo-D_EcoRI rev (GGCCCAATTCGTCAAAACGCTGGGTTTGC)...

Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf

... 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢Y116D 5¢-CGACGACGAGACAGACTCCCAGAACATGTC-3¢5¢-GACATGTTCTGGGAGTCTGTCTCGTCGTCG-3¢Y. Sun et al. ... assense and antisense, respectively, for each mutation.p26mutation PrimerR110G 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢F112R 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢R11 4A ... Chaperones 8, 381–394.70 Rajaraman K, Raman B, Ramakrishna T & Rao CM(2001) Interaction of human recombinant aA- andaB-crystallins with early and late unfolding intermedi-ates of citrate...

Báo cáo khoa học: "You Can’t Beat Frequency (Unless You Use Linguistic Knowledge) – A Qualitative Evaluation of Association Measures for Collocation and Term Extraction" pot

... Chapter of the Association for Com-putational Linguistics, pages 188–195. Toulouse,France, July 9-11, 2001. San Francisco, CA: Mor-gan Kaufmann.Katerina T. Frantzi, Sophia Ananiadou, and HidekiMima. ... University Language & Information Engineering (JULIE) LabD-07743 Jena, Germany{wermter|hahn}@coling-uni-jena.deAbstractIn the past years, a number of lexicalassociation measures have been studiedto ... domain-speciﬁc automatic termrecognition (ATR) and on general-language collo-cation extraction (CE) has gone mostly separateways in the last decade although their underlyingprocedures and goals turn...

Báo cáo khoa học: Exo-mode of action of cellobiohydrolase Cel48C from Paenibacillus sp. BP-23 A unique type of cellulase among Bacillales ppt

... Exo-mode of action of cellobiohydrolase Cel48C from Paenibacillus sp. BP-23 A unique type of cellulase among Bacillales Marta M. Sańchez, F. I. Javier Pastor and Pilar DiazDepartment of ... expres-sion and purification. The encoded enzyme, a cellulase of 1091 amino acids with a deduced molecular mass of 118 kDa and a pI of 4.85, displayed a multidomain organ-ization bearing a canonical family ... catalytic domain, a bacterial type 3a cellulose-binding module, and a putativefibronectin-III domain. The cloned cellulase, unique among Bacillales and designated Cel48C, was purified through a nity...

Tài liệu Báo cáo khoa học: Parvalbumin deficiency in fast-twitch muscles leads to increased ‘slow-twitch type’ mitochondria, but does not affect the expression of fiber specific proteins doc

... GGG AAG CTC ACT GG GTG AGG GAG ATG CTC AGT GTT GG 429 RT-PCRCaN AGTAACAATTTTCAGTGCTCCAAAC AATATACGGTTCATGGCAATACTGT 205 RT-PCRCaMKII CTACCCCGGCGCTGGAGTCAAC TCAGATGTTTTGCCACAAAGAGGTGCCTCCT 530 ... calculated from the gene bank databases. For quantitativeRT-PCR analyses, images of CaN, CaMKII and GAPDHamplicons from the same sample were acquired with a charge-coupled device (CCD) camera ... camera and analyzed quanti-tatively using the Gene Tools (Syngene, Cambridge, UK)software. For each sample, the CaN ⁄ GAPDH and CaM-KII ⁄ GAPDH ratios were calculated and the mean value of the...

Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

... were of analytical grade from Nacalai Tesque (Kyoto, Japan) andWako Pure Chemical Industries (Osaka, Japan).Culture and screening of bacteriaBacterial strains were cultivated for 15–20 h at ... mm each primer (5¢-GGAATTCCATATGTCCGCACCTTCCACCAGCACCG-3¢ and5¢-GGGAAGCTTTCAGCCAAGCAGCTCTTTCAGG-3¢),2.5 U LA Taq DNA polymerase, and 115 ng genomicDNA from P. putida ATCC12633: preincubation ... crudeextract; lane 3, after the Green-Sepharose CL-4B chromatography;lane 4, after the DEAE-Toyopearl chromatography.Table 1. Substrate speciﬁcity of NMAADH in the forward reaction.NMAADH activity...

Báo cáo khoa học: Arabidopsis thaliana CYP77A4 is the ﬁrst cytochrome P450 able to catalyze the epoxidation of free fatty acids in plants potx

... protein (512 amino acids) has a calcu-lated mass of 58 134 Da and a pI of 8.71. Enzymaticcharacterization of CYP7 7A4 was carried out employ-ing microsomes from the yeast strain WAT11 trans-formed ... physi-ological role of CYP7 7A4 . This lack of data couldexplain the small amount of information availabletoday concerning the ability of plant enzymes to gener-ate epoxides of fatty acids, despite ... only as a step leading to catabo-lism. The epoxidation of polyunsaturated fatty aciddouble bonds, particularly of arachidonic acid, hasgenerated much interest because of the biological activ-ities...

Báo cáo khoa học: Two L-amino acid oxidase isoenzymes from Russell’s viper (Daboia russelli russelli) venom with different mechanisms of inhibition by substrate analogs pdf

... a ligand to enter andanchor at the respective functional sites of LAAO that may facilitate thedesign of suicidal inhibitors.AbbreviationsLAAO,L-amino acid oxidase; NAT, N-acetyltryptophan; ... buffer with a linear ﬂow rate of 12 mLÆh)1,and 1.5 mL fractions were collected. The LAAO activity of each fraction was assayed using the coupled assay system,and the pH of each fraction was checked ... substrates of these enzymes are aromatic or,more generally, hydrophobic amino acids. Deamina-tion of polar and basic amino acids proceeds at a much lower rate [3,4].So far, LAAOs from bacterial,...

Báo cáo khoa học: Isoquinoline-1,3,4-trione and its derivatives attenuate b-amyloid-induced apoptosis of neuronal cells pdf

... MO, USA). Caspase peptidesubstrates Ac-DEVD-pNA, Ac-DEVD-AMC, N-acetyl-Val-Asp-Val-Ala-Asp-p-nitroanilide (Ac-VDVAD-pNA),N-acetyl-Val-Glu-Ala-Asp-p-nitroanilide (Ac-VEAD-pNA),and N-acetyl-Leu-Glu-His-Asp-p-nitroanilide ... 5Table 2. Selectivity of isoquinoline-1,3,4-trione and derivatives on caspases [IC50(lM)]. Data from compounds 1, 2, 3 and 7 is from [30].Caspase 2 Caspase-3 Caspase 6 Caspase 7 Caspase 8 Caspase ... China2 East China Normal University, Academy of Life Science, Shanghai, ChinaCaspases are involved in apoptosis and the inﬂamma-tory response. Of the 14 members of this protease fam-ily, caspase-3...

Báo cáo khoa học: Hemitoxin, the ﬁrst potassium channel toxin from the venom of the Iranian scorpion Hemiscorpius lepturus ppt

... andPSI-BLAST: a new generation of protein databasesearch programs. Nucleic Acids Res 25, 3389–3402.48 Sali A & Blundell T (1993) Comparative protein model-ing by satisfaction of spatial restraints. ... code Iv5 6A [25]) was from He. spinnifer; OcKTx1–5were from O. carinatus [23]; IsTx was from Op. madagascarensis [24]; anuroctoxin was from A. phaiodactylus [26]; and HgeTx1 was from Ha. gertschi ... Iranian scorpion Hemiscorpius lepturusNajet Srairi-Abid1,*, Delavar Shahbazzadeh1,2,*, Imen Chatti1, Saoussen Mlayah-Bellalouna1,Hafedh Mejdoub3, Lamia Borchani1, Rym Benkhalifa1,...

Xem thêm