0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: "Distributed Listening: A Parallel Processing Approach to Automatic Speech Recognition" pot

Báo cáo khoa học:

Báo cáo khoa học: "Distributed Listening: A Parallel Processing Approach to Automatic Speech Recognition" pot

... known as a unigram. The grammar consists of known utterances that can be made by the user. The unigram grammar is stored in a phrase database. The grammar is organized according to individual ... the accuracy of the transcription of spoken utterances. 1 Introduction Research in the area of natural language processing has been on-going for over thirty years (Natural Language Software ... goal of Distributed Listening research is to take a unique approach in order to enhance the success of the traditional approaches to speech recognition. The approach of Distributed Listen-ing...
  • 4
  • 252
  • 0
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

... (primers 5¢-GAGGATCCATGGAACAGAACAGGTTCAAG-3¢ and 5¢-CGGAATTCTTACAGTTTTTGTTTAGTCGTTTTAAC-3¢) was subcloned into EcoRV-digested pBluescript SK+, and then cloned into the BamHIand EcoRI sites ... (systematic name:Yor084wp) was extractable by low salt and identifiedtogether with the peroxisomal aspartate aminotransfer-ase Aat2p in HPLC fraction 7 at a molecular mass ofapproximately 45 kDa (Fig. ... (AAC71532) and with the putative triacylglycerol lipaseAAB96044 from Mycoplasma pneumoniae (Mp). Identical aminoacids are indicated by an asterisk and similar amino acids are indi-cated by a colon and...
  • 11
  • 568
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "WSD as a Distributed Constraint Optimization Problem" pptx

... approaches: These approachescrucially rely on lexical knowledge base.Graph-based WSD approaches (Agirre andSoroa, 2009; Sinha and Mihalcea, 2007) per-form disambiguation over a graph composedof ... of a feature vector and models were built by trainingon sense-tagged corpora. These approaches poseWSD as a classification problem. They cruciallyrely on hand-tagged sense corpora which is hard to ... HyderabadIndiagvsreddy@students.iiit.ac.inAbhilash InumellaIIIT HyderabadIndiaabhilashi@students.iiit.ac.inAbstractThis work models Word Sense Disam-biguation (WSD) problem as a Dis-tributed...
  • 6
  • 369
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

... harm or an increase in patient monitoring with nochange in vital signs and no harm noted. Moderate errors wereclassified as those causing an increase in patient monitoring, a change in vital ... rateanalysis.The patient outcome from each error were assigned by thepharmacist and the ICU clinical director, according to anadapted scale [9-11]. Minor errors were classified as thosecausing ... the third case, vancomycin was pre-scribed 1 g intravenously daily to a patient in renal failure,when the appropriate dose would have been to give 1 g andthen to repeat when the plasma levels...
  • 6
  • 526
  • 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... substantianigra is a neuropathological hallmark of Parkinson’sdisease. This leads to a decreased level of dopamine inthe striatum. As a result, synaptic transmission is nega-tively affected ... protective action of rasagiline, a MAO-B inhib-itor, on the aggregation of a- synuclein, is because of itsaction as a free radical scavenger [36]. Thus, it may bespeculated that dopamine exhibits a ... pH was raised immediately to 7.5 and centrifu-gation was carried out at 15 000 g for 1 h. The clearedsupernatant was purified by DEAE-Sepharose anionexchange chromatography [18]. The eluates...
  • 11
  • 754
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... Chang CK (1994) Heme d1and other heme cofactorsfrom bacteria. Ciba Found Symp 180, 228–238.24 Van Spanning RJ, Wancell CW, De Boer T, HazelaarMJ, Anazawa H, Harms N, Oltmann LF & StouthamerAH ... the total cell lysate and theperiplasmic fraction, but was absent from the membrane and cytoplasmic fractions. (B) The same cell fractions as shown in (A) when sub-jected to SDS ⁄ PAGE analysis ... aqueous acetonitrile,0.1% trifluoroacetic acid) at a 1 : 1 ratio and 1 lLofmixture applied directly to the sample plate. The dropletwas air-dried before analysis in the MS. MALDI spectrawere obtained...
  • 12
  • 613
  • 0
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc

... red).Table 1. Average distances between CA atoms of the stefins andcatalytic residues of cysteine proteases.Distance calculated d (A ˚)Papain–stefin B 23.93Cathepsin H–stefin A 23.36 ± 0.23Cathepsin ... theP1 data set is a consequence of highly anisotropic diffrac-tion, which forced us to discard part of the collected data to maintain reasonable merging statistics. The anisotropywas a consequence ... Stefin A displaces the occluding loop of cathepsin B onlyby as much as required to bind to the active site cleftMiha Renko, Ursˇka Pozˇgan, Dusˇana Majera and Dusˇan TurkDepartment...
  • 8
  • 632
  • 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 ... CGTATAAATTACAATACCGSpcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x ... CAAGCAGGTGAATTAGGCSpcoq7-x GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x...
  • 16
  • 646
  • 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc

... PCR with Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned into the EcoRV ... that mammalian Gup1, a mem-ber of the MBOAT superfamily bearing sequence simi-larity to HHAT, acts as a negative regulator ofN-terminal palmitoylation of Shh. Several reports havedemonstrated ... COS7 cells affecting the 5E1 epitope.Gup1 acts as a negative regulator for N-terminalpalmitoylation of ShhMammalian Gup1 has been described in the gene data-base cited above as a homolog of...
  • 14
  • 499
  • 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... 5¢-CTCGAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCAGGGG-3¢ for the latter. The ... organ-specific blood vascular and lymphaticendothelial cells of the mouseTakashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki Yoshida and Hirotake ... receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA,paraformaldehyde; Prox-1, prospero-related homeobox-1; SV40T Ag, SV40 large T antigen; tsA58T Ag,...
  • 11
  • 873
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ