Báo cáo khoa học: "Translating from Morphologically Complex Languages: A Paraphrase-Based Approach" pptx
Báo cáo khoa học: "Translating from Morphologically Complex Languages: A Paraphrase-Based Approach" pptx
... setiap satu yang boleh menampung kelas seramai 30pelajar, selain bekalan-bekalan lain seperti 500 khemah biasa, barang makanan dan ubat-ubatan untuk mangsa gempa Sichuan.ref1: Mercy Relief has ... regarded as separate languages,which are mutually intelligible, but occasionally dif-fer in orthography/pronunciation and vocabulary:Bahasa Malaysia (lit. ‘language of Malaysia’) andBahasa ... makekereta api and keretapi in Bahasa Indonesia andBahasa Malaysia, respectively, both meaning‘train’. As in English, Malay compounds arewritten separately, but some stable ones likekerjasama/‘collaboration’...
- 10
- 368
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLUR1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAACTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢-GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTTTGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTTTGGATGCTATTAATGATGATGGCTC-3¢), ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAATGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTTAACAGATATGCCGGTTATT CCACCGGT GCC-3¢), GLUT46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCATATCTGTTAAGTTGTTC-3¢); ... H44 7A, D45 0A for-ward (5¢-GCAAGTCATTTTGGATGCTATTAATGCTGATGGCTCCTTGAATGAAC-3¢), GLU H44 7A, D45 0A Fig. 7. Adsorption to raw starch of Glu and R1 5A, H44 7A, T46 2A, H44 7A + D45 0A mutants (A) and...
- 11
- 548
- 0
Báo cáo khoa học: "Translating HPSG-style Outputs of a Robust Parser into Typed Dynamic Logic" pot
... such as “the event” and “that case”, canbe treated in the same manner.2.2 Head-driven Phrase StructureGrammarHead-driven Phrase Structure Grammar (Pollardand Sag, 1994) is a kind of lexicalized ... andcompositional, which makes its interface withsyntax tr ansparent and st raightforward. This is a significant advantage for achieving robustnessin natural language processing.2 Background2.1 ... corpus-oriented parsers (Baldwin,to appear).The lack of transparency between syntax anddiscourse semantics appears to have created a tension between the robustness of syntax andthe descriptive adequacy...
- 8
- 250
- 0
Báo cáo khoa học: "PDT 2.0 Requirements on a Query Language" pptx
... meaning is as-signed a valency frame. Verbs usually have more than one meaning; each is assigned a separate va-lency frame. Every verb has as many valency frames as it has meanings (t-manual, ... the analytical layer may be (and often are) represented by one node on the tectogrammat-ical layer and new nodes without an analytical counterpart may appear on the tectogrammatical layer. ... necessary that the query language ad-dresses this issue and allows access to the informa-tion from the lower layers.2.2 The Analytical and Morphological LayerThe analytical layer is much less complex...
- 9
- 351
- 0
Báo cáo khoa học: "Ordering Prenominal Modifiers with a Reranking Approach" potx
... theincrease we attain in system performance.6 AnalysisMAXENT seems to outperform the CLASS BASEDbaseline because it learns more from the trainingdata. The CLASS BASED model classifies eachmodifier ... We canexpress this as a real-valued feature:φ(B,H, x)=count in training data of alln-grams present in xSee Table 2 for a summary of our features. Manyof the features we use are similar ... Switchboard, WSJ, and NANC.The test data was held out and each approach was trained on the rest of the data. Winning scores are in bold. Thenumber of features used during training for the MAXENT approach...
- 8
- 333
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf
... w as from Sigma. Potassium trithionate was a gift from PeterM. H. Kroneck (Universita¨t K onstanz). All other chemicalswere from Merck. The chromatographic materials were from Amersham Pharmacia ... identified asan archaeal promoter element by seque nce analysis. The sequ ence AAAGGTTAATATA shows a high le vel of identity with th e consensus se quence()35 to )23, AAANNNTTATATA) ; the sequence ... sequence regionupstream o f A F499 is AT-rich and contains typical a rchaealpromoter elements. The sequence AAAGGTTAATATAwas f ound 64 bp upstream of the start codon of AF499; thiscorresponds...
- 10
- 564
- 0
Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx
... Oxo-phytodienoicacid-containing galactolipids in Arabidopsis: jasmonatesignaling dependence. Plant Physiol 145, 1658–1669.47 Buseman CM, Tamura P, Sparks AA, Baughman EJ,Maatta S, Zhao J, Roth ... A and BIvan R. Chechetkin, Fakhima K. Mukhitova, Alexander S. Blufard, Andrey Y. Yarin,Larisa L. Antsygina and Alexander N. GrechkinKazan Institute of Biochemistry and Biophysics, Russian Academy ... of flax leaves. Galactolipids wereseparated and purified as described in Materials and methods. EDEcontent was measured by UV absorbance of MGDG and DGDGfractions at 267 nm. Average values and...
- 10
- 387
- 0
Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx
... DNA damage before it isdephosphorylated. If this is the case, removal from theaction of the ataxia telangiectasia mutated (ATM) ⁄ataxia telangiectasia and RAD53 related (ATR)kinases at the ... ataxia telangiectasia mutated; ATR, ataxia telangiectasia and RAD53 related; 4NQO, 4-nitroquinoline 1-oxide; FACS, fluorescentactivated cell sorter; H2AX, histone 2AX; MMS, methylmethanesulfonate; ... of DNA damage may decrease thekinase ⁄ phosphatase ratio and allow the phosphatase todephosphorylate cH2AX.In mammalian cells, PP 2A isoforms, the orthologuesof S. cerevisiae Pph21p and Pph22p,...
- 11
- 362
- 0
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt
... decarboxylation catalysed by a- amino-b-carboxymuconate-e-semialdehyde decarbox-ylase. J Am Chem Soc 129, 9278–9279.20 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & ... Walker AL, Iwaki H, Hasegawa Y & Liu A (2005) Kinetic and spectroscopic characterization ofACMSD from Pseudomonas fluorescens reveals a penta-coordinate mononuclear metallocofactor. J Am ... glycolysisSilvia Garavaglia1, Silvia Perozzi1, Luca Galeazzi2, Nadia Raffaelli2and Menico Rizzi11 DiSCAFF Dipartimento di Scienze Chimiche, Alimentari, Farmaceutiche e Farmacologiche,...
- 9
- 796
- 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... DNAsequences flanking the Jannaschia sp. CCS1 HYDJsrevealed an ORF encoding a putative allantoate amido-hydrolase, which is part of the urate catabolic pathwayin many organisms [8]. In fact, ... molecular masswas also estimated by SDS–PAGE.Characterization and comparative analyses ofHYDJsand HYDBpThe optimal temperature for activity of HYDJswith d-p-HPH as substrate was determined ... ofmicrobial hydantoin-transforming enzymes. J Mol CatalB Enzym 2, 163–176.13 Bommarius AS, Schwarm M & Drauz K (1998) Biocatal-ysis to amino acid-based chiral pharmaceuticals - exam-ples and...
- 14
- 621
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ