Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc

... Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein Lisa Rosgaard*, Agnieszka Zygadlo, ... 5¢-GCGGAGCTCATGGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCTCAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTGGGTCGTAT-3¢ (His-tag underlined); PSAG with a C-ter-minal Strep-tag (PSI -G- StrepTerm), 5¢-GCGGAGCTCATGGCCACAAGCGCATCAGC-3¢ ... tagged PSI -G into PSIWhilst it is evident that both C-terminally and loop- tagged PSI -G can insert into the thylakoid in vivo (Figs 4 and 5), it is possible that the tags hinder assem-bly into...

Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identiﬁcation of oscillophores ppt

... welinearize the system of Eqn (3) in the vicinity of the steadystate. We do this to investigate the stability of this state. In this way we obtain the in uence a small change in the concentration ... identify ÔnegativeÕ subgraphs, because theycan induce instability; their positive combined autoinﬂuencebestows them with oscillophoretic potential. The instability condition that apbe negative ... of Systems Biology, dissecting the system into various inter-acting kinetic regimes, whilst relating to molecular mecha-nisms.Various types of approach can be helpful here. Graph-theoretic...

Báo cáo khoa học: A (1ﬁ3)-b-D-glucan recognition protein from the sponge Suberites domuncula Mediated activation of ﬁbrinogen-like protein and epidermal growth factor gene expression pot

... selected for the design of degenerate primers. Aligning different fibrinogen-domain containing proteins, fibrinogens, fibroleukins/techylectins, angiopoietins, ficolins and tenascins, the following consensus ... (1fi3)-b-D-glucan-binding protein, which bindto (1fi3)-b-D-glucans, e .g. curdlan or laminarin. Afterbinding of the carbohydrate to the receptor, the expression of the gene coding for the binding protein increases. ... elicitor-binding protein of different structure [61].Following a previously described approach [12], the (1fi3)-b-D-glucan-binding protein was identified biochem-ically. The binding of the linear...

Báo cáo khoa học: Heavy metal ions inhibit molybdoenzyme activity by binding to the dithiolene moiety of molybdopterin in Escherichia coli pdf

... the reaction mixture did not result in their insertion into MPT (data not shown). In addition, wetested the insertion of metal ions into MPT-containinghSO. None of the metals was inserted into ... aqua-glyceroporins (glycerol transportproteins) in bacteria, yeast and mammals [26], and itstoxicity lies in its ability to bind sulfhydryl groups of cysteine residues in proteins, thereby inactivating them.Arsenite ... Vanadate ions also mimicmost of the rapid actions of insulin in the cell [37]. In this report, we examined the in vivo and in vitro incorporation of metal ions of molybdenum, tungsten,vanadium,...

Báo cáo khoa học: Human ATP-dependent RNA ⁄ DNA helicase hSuv3p interacts with the cofactor of survivin HBXIP ppt

... thatbinds the HBx protein encoded by the hepatitis B virus. Using deletionanalysis we identiﬁed the region within the hSuv3 protein, which is respon-sible for binding to HBXIP. The HBXIP binding ... (forward; incorporating EcoRI site, underlined) and GCGGGATCCGAAACCGTGAGCTGAATCTGCC(reverse, incorporating BamHI site, underlined). The result-ing fragment was cloned into pEG202 using EcoRI and BamHI. The ... fraction of truncated Suv3p, i. e. lack-ing the C-terminal HBXIP binding domain, can befound in the cytosol, the binding of HBXIP mayABFig. 5. The role of the C-terminal, HBXIP interacting,...

Báo cáo khoa học: Afﬁnity puriﬁcation-mass spectrometry Powerful tools for the characterization of protein complexes ppt

... number of diﬀerentproteins into functional units. Many a time, when studying protein complexes rather than individual proteins, the bio-logical insight gained has been fundamental, particularly in cases ... within this diverse set of molecules, it is critical to maintain functional organiza-tion. It is becoming increasingly clear that an importantlevel of organization is provided by multi protein ... beinvolved in signaling processes related to the regulation of synaptic plasticity by binding to the adaptor protein PSD95. This protein contains several PDZ domains one of which binds to the...

Báo cáo khoa học: Swollenin, a Trichoderma reesei protein with sequence similarity to the plant expansins, exhibits disruption activity on cellulosic materials pptx

... functionally important. The N-terminal half of the expansins contains eight conservedcysteines with a spacing similar to that of cysteines in the chitin binding domain of wheat germ agglutinin ... binding domain, QQ, two glutamines suggested to form the N-terminus of the matureswollenin. The numbering refers to amino-acid positions in the mature protein. In (B), the invariant amino acids ... several other bands in addition to the onesoriginating from swo1, suggesting that there are other geneshaving expansin-like domains present in the T. reeseigenome in addition to swo1 (Fig. 4). The...

Tài liệu Báo cáo khoa học: Is ATP binding responsible for initiating drug translocation by the multidrug transporter ABCG2? docx

... the protein contains a number of interconnected drug bindingsites. The present investigation examines the coupling of drug binding toATP hydrolysis. Initial drug binding to the protein requires ... binding, Bmaxis the maximal binding, Bminis the minimum binding, IC50is the concentration of drug that leads to half-maximal bind-ing of radiolabel (nm), n is the Hill slope factor and L islog10[ligand ... switch from the initialhigh-affinity, inward-facing configuration to anoutward-facing, low-affinity configuration to facilitatedissociation [26]. Originally, the impetus for the switch in binding...

Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high speciﬁc activity from Pisum sativum catalytically translocates in the 3¢ﬁ5¢ direction docx

... 2003 and actinomycin C1were inhibitory to the enzymeactivity (Fig. 6A, lanes 4–7). The kinetics of inhibitionby these inhibitors was studied by including differentconcentrations of actinomycin ... (Mg2+>Mn2+)isrequired .The DNA intercalating agents actinomycin C1, ethidium bro-mide, daunorubicin and nogalamycin inhibit the DNAunwinding activity of PDH120 with K i values of 5.6, 5.2, 4.0 and ... Actinomycin C1, a polypeptide containing the properties of an antibiotic, intercalates into dsDNA and thereby inhibits nucleic acid synthesis [23]. Nogalamycin and daunorubicin are anthracycline...

Báo cáo khoa học: "Insertion, Deletion, or Substitution? Normalizing Text Messages without Pre-categorization nor Supervision" docx

... data pairs containing digits,but remove the data pairs with chunks involvingthree letters or more in either the dictionary word or the variant. For the chunk alignments in the remain-ing pairs, ... pre-categorizing the nonstandard to-kens into insertion, deletion, substitution, etc. Wealso avoided the expensive and time consuming handlabeling process by automatically collecting a largeset of ... Linguistics Insertion, Deletion, or Substitution? Normalizing Text Messages withoutPre-categorization nor SupervisionFei Liu1Fuliang Weng2Bingqing Wang3Yang Liu11Computer Science Department, The...

Xem thêm