0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: BGN16 3, a novel acidic b-1,6-glucanase from mycoparasitic fungus Trichoderma harzianum CECT 2413 ppt

Báo cáo khoa học: BGN16.3, a novel acidic b-1,6-glucanase from mycoparasitic fungus Trichoderma harzianum CECT 2413 ppt

Báo cáo khoa học: BGN16.3, a novel acidic b-1,6-glucanase from mycoparasitic fungus Trichoderma harzianum CECT 2413 ppt

... BGN16. 3, a novel acidic b-1,6-glucanase from mycoparasitic fungus Trichoderma harzianum CECT 2413 Manuel Montero1, Luis Sanz1, Manuel Rey2, Enrique Monte1and Antonio Llobell31 ... E & Garcia-Acha I(1997) Physiological and biochemical characterization of Trichoderma harzianum, a biological control agent ofsoilborne fungal plant pathogens. Appl Envir Microbiol 63, ... harzianum CECT 2413 (2) after 24 or 48 h growing onchitin or B. cinerea cell walls as sole carbon source. Acidic b-1,6-glucanase from Trichoderma harzianum M. Montero et al.3442 FEBS Journal...
  • 8
  • 327
  • 0
Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc

Báo cáo khoa học: Nautilin-63, a novel acidic glycoprotein from the shell nacre of Nautilus macromphalus doc

... measurements.References1 Mann S (1988) Molecular recognition in biomineraliza-tion. Nature 332 , 119–124.2 Sudo S, Fujikawa T, Nagakura T, Ohkubo T, Sakagu-chi K, Tanaka M, Nakashima K & Takahashi T (1997)Structure ... FEBSNautilin- 63, a novel acidic glycoprotein from theshell nacre of Nautilus macromphalusBenjamin Marie1,2, Isabelle Zanella-Cle´on3, Marion Corneillat4, Michel Becchi3,Ge´rard Alcaraz2,4,Laurent ... layers (approximately 0.5 lm) of tablet-like aragonite crystals separated by interlamellar layersof organic matrix. This apparent simple geometry facili-tates various structural investigations...
  • 14
  • 383
  • 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx

... CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG2 851 CTTCTCCCGgtgtgcac 403 gtccccagGCCGGATCA364AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG4 172 CAACAAAGgtacatgc 1335 ctgtgcagGTACTGGTG5 1028 A. Ray et al. ... the SAF-1/MAZ/Pur-1family, is expressed during inflammationAlpana Ray1, Srijita Dhar1, Arvind Shakya1, Papiya Ray1, Yasunori Okada2and Bimal K. Ray11 Department of Veterinary Pathobiology, ... 1027–1035.17 Ray A, Ray P, Guthrie N, Shakya A, Kumar D &Ray BK (2003) Protein kinase A signaling pathway regu-lates transcriptional activity of SAF-1 by unmasking itsDNA-binding domains. J...
  • 11
  • 439
  • 0
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

... is crucial to stabilize the organiza-tion of transvacuolar strands and maintain overallcellular architecture. As mentioned above, CRP1 mayparticipate in the formation and ⁄ or maintenance oflong ... F-actin concentration was 8 lM.After SDS ⁄ PAGE and staining, gels were scanned and the amount of protein that was present in the pellet and supernatant was quantified.The concentration of actin-bound ... pellets (P) and supernatants (S) were analyzed by SDS ⁄ PAGE and stained with Coomassie Brilliant Blue. (C)Quantitation analysis for GST–hhLIM association with F-actin at different concentrations...
  • 11
  • 347
  • 0
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

... Purandare AV, Chen Z, Huynh T, Pang S, Geng J,Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayar-aman L (2008) Pyrazole inhibitors of coactivator associ-ated arginine methyltransferase 1 (CARM1). ... transcription,protein and RNA subcellular localization, RNAsplicing, DNA damage repair, and signal transduction[2]. Nine PRMT family members have been clonedand characterized to date, with putative 10th and ... catalyzemonomethylation as a reaction intermediate [4].Post-translational modifications within T-cell-recep-tor signaling cascades allow T lymphocytes to initiate a rapid and appropriate immune response to patho-gens....
  • 13
  • 646
  • 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

... 5¢-GACTGTCGATGATTATGGTTGCCCGCTGGCTTCCAAACCCTTATCGATACCGTCGACCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACAGGAAACAGCTATGACCATGATTACGCTATAGGGCGAATTGGGTA-3¢, respectively. YEp351-SUT2was linearized with SphI and co-transformed ... disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 wasconstructed to contain SUT2 as the only open readingframe present in the plasmid ... 5¢-TATTAATATTCCTATATTTTACATAGGAGGAAATTACATGCATGAAACCTACAGCTGAAGCTTCGTACGC-3¢, respectively. The plasmid pFL38-RAS2 was con-structed by ligating the 3 kb HindIII/EcoRI-RAS2 frag-ment from plasmid YCplac22-RAS2...
  • 8
  • 485
  • 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc

... (5¢-GAATTCatgaaggttctcctccactg-3¢)and rO-MACS-XhoI-D (5¢-CTCGAGtgcccgtccccactcctggt-3¢)for o-macs; EcoRI-mMACS1-U (5¢-GAATTCatgcagtggctgaagagttt-3¢) and mMACS1-XbaI-D (5¢-TCTAGAtagctgaccaaactccttg-3¢)forMACS1, ... 1997(forward), 5¢-ggttaaacaccacagaggcc-3¢ (reverse); OCAM5¢-gagaagtggtgtcccctcaa-3¢ (forward), 5¢-cctccatcatcttgcttggt-3¢ (reverse); NCAM 5¢-cttcctgtgtcaagtggcag-3¢ (for-ward), 5¢-gttggcagtggcattcacga-3¢ ... 5¢-gttggcagtggcattcacga-3¢ (reverse); and NeuroD5¢-aagacgcatgaaggccaatg-3¢ (forward), 5¢-catgatgcgaatggctatcg-3¢ (reverse). Hybridization, washing, antibody reactionand color detection were performed as described...
  • 10
  • 393
  • 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... TCATCTTTTAAACTTTGGGCGAAGGCGTTT23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA25 ATATTATATATATATATAGGGTCGTATATA26 AAATTATAGAAAGCAGTAGA TAAAACAATG27 CTTCGAAGAATATACTAAAAAATGAGCAGGCAAGATAAACGAAGGCAAAGTTCAATTCATCATTTTTTTTTTATTCTTTT28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA4 CCCCGAATTCAAATTATAGAAAGCAGTAGA5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC6 AAAAGTCGACGAGCTCGTTTTCGACACTGG7 TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC8 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT9 ... TTTTGTCGACATGGCGCAACACGATGAAGCCGTAGACAAC18 GGGGGGATCCTTACATAAGCGTACAACAAACACTATTTGATTTCGGCGCCTGAGCATCATTTAGCTTTTT19 ATCCAAAGTTTAGCCGATGACCCAAGCCAA20 TTGGCTTGGGTCATCGGCTAAACTTTGGAT21 AAACGCCTTCGCCCAAAGTTTAAAAGATGA22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT23...
  • 9
  • 444
  • 0
Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx

... Coo-massie blue, 2-mercaptoethanol, etc. were purchased from Sigma-Aldrich, St Louis, MO, USA.Bacterial strainThe strain isolated from soil samples was identified as a bacterium, A. faecalis according ... acyl-CoA.We have isolated a thioesterase from Alcaligenesfaecalis ISH108 and demonstrated its application inchemoselective and racemization free deacylation ofthiol esters [17]. A. faecalis was ... acyl-CoAthioesterase from Alcaligenes faecalisPuja Shahi*†, Ish Kumar*‡, Ritu Sharma, Shefali Sanger and Ravinder S. JollyInstitute of Microbial Technology, Chandigarh, IndiaLong-chain acyl-CoA thioesterases...
  • 14
  • 513
  • 0
Báo cáo khoa học: Calpain 3: a key regulator of the sarcomere? pot

Báo cáo khoa học: Calpain 3: a key regulator of the sarcomere? pot

... TC,Kawasaki H, Sugita H, Miyasaka M, Arahata K,Ishiura S & Suzuki K (1993) Muscle-specific calpain,p94, is degraded by autolysis immediately after transla-tion, resulting in disappearance from ... Bulgaria, Canada, France, Germany, Greece, USA, Italy, Japan,Lebanon, the Netherlands, Poland, Russia, Spain, Switzerland,Turkey, UK, USA, VietnamPogoda et al. 2000 PMID: 10679950 RussiaChae ... degeneration in the earliest stages of LGMD 2A. J Clin Pathol 56, 624–626.52 Chrobakova T, Hermanova M, Kroupova I, VondracekP, Marikova T, Mazanec R, Zamecnik J, Stanek J,Havlova M & Fajkusova...
  • 10
  • 350
  • 0

Xem thêm

Từ khóa: phần 3 báo cáo khoa học tổng kết đề tài khcn 08 04 chọn tạo giống và nhân giống cho một số loại cây trồng rừng chủ yếubài báo báo cáo khoa học 3 bài đăng trên tạp chí chuyên ngành 1 bài đăng trên tuyển tập hội nghị khoa học quốc tếtuyên tập cac bao cao khoa học hội nghị khoa học địa i apos abáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM