0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Interaction of synthetic peptides corresponding to hepatitis G virus (HGV/GBV-C) E2 structural protein with phospholipid vesicles doc

Báo cáo khoa học: Interaction of synthetic peptides corresponding to hepatitis G virus (HGV/GBV-C) E2 structural protein with phospholipid vesicles doc

Báo cáo khoa học: Interaction of synthetic peptides corresponding to hepatitis G virus (HGV/GBV-C) E2 structural protein with phospholipid vesicles doc

... 2005)doi:10.1111/j.1742-4658.2005.04666.xThe interaction with phospholipid bilayers of two synthetic peptides with sequences corresponding to a segment next to the native N-terminus andan internal region of the E2 structural hepatitis ... pI(6.14) of the parent E2( 279–298) peptide.Binding of E2 peptides to model membranesLipid interaction of the E2 peptides was studied bymonitoring Trp fluorescence changes on titration of peptide ... internal segment peptide sequence is involved in the fusion of HGV ⁄ GBV-C to membrane.AbbreviationsE, envelope proteins; HCV, hepatitis C virus; HGV ⁄ GBV-C, hepatitis G virus; LUV, large unilamellar...
  • 11
  • 477
  • 0
Báo cáo khoa học: Study of synthetic peptides derived from the PKI55 ppt

Báo cáo khoa học: Study of synthetic peptides derived from the PKI55 ppt

... inhibitory action of peptides 5and 8 on the b1isoform was found to be significantlyhigher (P < 0.05) compared to the whole PKI55 protein. Effects of selected peptides on PMNinflammatory ... working strength stocksolution with the following composition: NaCl 40 g L)1;KCl 1.875 g L)1;Na2HPO4.2H2O 0.6 g L)1;KH2PO40.125 g L)1; NaHCO31.25 g L)1; and glucose 10 g L)1.1mm ... TB & GerardC (1992) Mapping of genes for the human C5a receptor(C5AR), human FMLP receptor (FPR), and twoFMLP receptor homologue orphan receptors (FPRH1,FPRH2) to chromosome 19. Genomics...
  • 9
  • 427
  • 0
Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc

Báo cáo khoa học: Prevalence of intrinsic disorder in the hepatitis C virus ARFP/Core+1/S protein doc

... CGG GGT CTCCCA-TG GCA ATG AGG GCT GCG GGT G- 3¢; HCV-1bCore+1/S sense, 5¢-ATC CGG GGT CTCCCATG GCAATG AGG GCC TGG GGT G- 3¢; HCV-1a Core+1/Santisense, 5¢-AT CCG GGT CTCGGTACC TTA TCACGC ... TTA TCACGC CGT C TT CCA GAA C-3¢; and HCV-1b Core+1/Santisense, 5¢-AT CCG GGT CTCGGTACC CTA GGGGGG CGCC G A CG-3¢ (italic indicates BsaIsites;underlined sequences correspond to Nco I sites ... Boumlic was recipient of doctoral grants from the ANRS and the EuropeanDoctoral College of the University of Strasbourg.We thank H. Nierengarten (CEBGS, IGBMC) forperforming MS analysis, A. Kakkanas...
  • 16
  • 498
  • 0
Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc

Báo cáo khoa học: Biosynthesis of platelet glycoprotein V expressed as a single subunit or in association with GPIb-IX doc

... processing of GPV in CHO and K562 cells c otransfected with GPV and GPIb-IX. (A) CHO cell s stablytransfectedwithGPV,GPIba,GPIbßandGPIXwereanalysedforsurfaceexpression of GPV b y flow cytometry. ... soluble form of GPVThe CHO/GPV cell line transfected with full length GPVlacked surface expression of GPV as m easured by flowcytometry (Fig. 1A), despite selection of a stronglyexpressing clone ... ais du Sang-Alsace, Strasbourg, FranceGlycoprotein (GP) V is noncovalently linked to GPIba,GPIbb and GPIX within the platelet GPIb–V–IX complex,a receptor for von Willebrand factor and thrombin....
  • 7
  • 363
  • 0
Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc

Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc

... actin[5]. Aggregation was followed by light scattering, measuredat 560 nm, again using the Hitachi F-3000 fluorescencespectrophotometer.Ultracentrifugation was also used to follow aggregation of partially ... lM) was cooled to 25 °C, andaggregation was initiated by the addition of KCl and MgCl2up to 50 mMand 2 mM, respectively. The increase of ionicstrength promotes aggregation of thermally ... aggregationLight scattering, ultracentrifugation and size-exclusionchromatography were used to follow the process of actinaggregation. After heating in buffer G under differentconditions G- actin...
  • 10
  • 431
  • 0
Báo cáo khoa học: Interaction of the general transcription factor TnrA with the PII-like protein GlnK and glutamine synthetase in Bacillus subtilis potx

Báo cáo khoa học: Interaction of the general transcription factor TnrA with the PII-like protein GlnK and glutamine synthetase in Bacillus subtilis potx

... calorimetry of (A) ADP,(B) AMP and (C) GTP binding to GlnK.Fig. S2. TnrA C-terminal truncations.Fig. S3. Crosslinking analysis of truncated TnrAproteins. Doc. S1. Purification of His6-tagged TnrA proteins,purification ... negative regulator of glnA and gltAB ,encoding the ammonium assimilatory enzymes gluta-mine synthetase (GS) and glutamate synthase, respec-tively [6–8]. TnrA belongs to the MerR family of transcription ... nitrogen availability inB. subtilis [1,9]. The feedback-inhibited form of GSbinds tightly to TnrA, preventing its binding to DNA, with the most effective feedback inhibitors of GS beingglutamine...
  • 11
  • 596
  • 0
Báo cáo khoa học: Interaction of human stefin B in the prefibrillar oligomeric form with membranes Correlation with cellular toxicity doc

Báo cáo khoa học: Interaction of human stefin B in the prefibrillar oligomeric form with membranes Correlation with cellular toxicity doc

... under-standing of the detailed mechanism of protein aggrega-tion and the resulting cellular toxicity should lead to rational drug design for this type of disease. Protein aggregation can result ... b2-microglobulin or prion fragments, exerttoxicity by forming pores in membranes, initiating a cascade of detrimentalevents for the cell. Interaction of granular aggregates and globular oligo-mers ... does not aggregate under any of the conditions studied. This study is aimed to contribute to the generalmodel of cellular toxicity induced by prefibrillar oligomers of amyloido-genic proteins,...
  • 10
  • 476
  • 0
Báo cáo khoa học: Interaction of Sesbania mosaic virus movement protein with the coat protein – implications for viral spread Soumya Roy Chowdhury and Handanahal Subbarao Savithri docx

Báo cáo khoa học: Interaction of Sesbania mosaic virus movement protein with the coat protein – implications for viral spread Soumya Roy Chowdhury and Handanahal Subbarao Savithri docx

... site is underlined.E.CP senseE.CP antiCCGCATATGGGAATTCATGATGGCGAAAAGGCTTTCGCCGCATATGGGAATTCGTTGTTCAGGGCTGAGGCPrimers for amplification of the CP gene. The EcoRI site isindicated in bold ... Sequence (5¢fi3¢) DescriptionMP senseMP antiCCGGCTAGCGGAATTCATGATGGTAATGCAAGCTCAGCATACTCCGGGAATTCGGAGGAGGACATAGCCCTPrimers for amplification of the MP gene. The EcoRI site isindicated in bold ... CCGCATATGGGAATTCATGATGGTATTCATTGGTTTTGAGGAC Primer for amplification of the MP ND16 gene. The EcoRIsite is indicated in bold and the NdeI site is underlinedE.MP.N49 sense CCGCATATGGGAATTCATGATGGTAGTGAGAGCCCACAACCAA...
  • 16
  • 527
  • 0
Báo cáo khoa học: Interaction of G-rich GT oligonucleotides with nuclearassociated eEF1A is correlated with their antiproliferative effect in haematopoietic human cancer cell lines potx

Báo cáo khoa học: Interaction of G-rich GT oligonucleotides with nuclearassociated eEF1A is correlated with their antiproliferative effect in haematopoietic human cancer cell lines potx

... 275¢-TGGTGTGTGTGGGGTGGTTGGTG-3¢ GT -G1 235¢-TGGGGTGTGTGGGGTGGTTGGTG-3¢ GT -G2 235¢-TGGGGTGTGTGGGGGGGTTGGTG-3¢ GT -G3 235¢-TGGTTGGGGTGGGGGGGGGGGTG-3¢ GT -G4 23B. Scaggiante et al. GT oligonucleotides, ... oligomer119764729123456–GTGT -G1 GT -G2 GT -G3 GT -G4 12 3 4 5kDa119764729ABFig. 3. Binding of the G- rich GT oligomers to total nuclear proteins.(A) Competition of binding to GT. Three micrograms of totalnuclear ... lack of competition by GT -G4 (lane 6). Competition by120100806040GTGT -G1 GT -G2 GT -G3 GT -G4 2000510ODN concentration(µM)% of cellular growth15Fig. 2. Cytotoxicity of G- rich GT oligomers....
  • 12
  • 376
  • 0
Báo cáo khoa học: Interaction of gymnemic acid with cyclodextrins analyzed by isothermal titration calorimetry, NMR and dynamic light scattering doc

Báo cáo khoa học: Interaction of gymnemic acid with cyclodextrins analyzed by isothermal titration calorimetry, NMR and dynamic light scattering doc

... determined for the interaction of GA and c-CD [22,26].Analyses using NMR and DLS showed the aggrega-ted property of GA. Aggregation should be due to thehydrophobic property of GA, which is also ... unbound GA is in awater-soluble aggregate that is dispersed when it forms a complex with c-CD. Dynamic light scattering showed that the average diameter of unbound GA is > 30 nm and that of GA ... nm,similar to unbound c-CD, supporting the aggregate property of GA andthe inclusion complexation of GA by c-CD.AbbreviationsCD, cyclodextrin; DLS, dynamic light scattering; GA, gymnemic acid;...
  • 7
  • 502
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)