0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Induction of raft-like domains by a myristoylated NAP-22 peptide and its Tyr mutant potx

Tài liệu Báo cáo khoa học: Modulation of sterol homeostasis by the Cdc42p effectors Cla4p and Ste20p in the yeast Saccharomyces cerevisiae pptx

Tài liệu Báo cáo khoa học: Modulation of sterol homeostasis by the Cdc42p effectors Cla4p and Ste20p in the yeast Saccharomyces cerevisiae pptx

... indicated strainswere grown to stationary phase and then lipids were extracted and separated by TLC. The amount of SE of the wildtype strain was setat 100%. Data are mean values of three independent ... betweenSte20p and the SE synthases Are1p and Are2p isspecific. Binding between Cla4p and Are1p or Are2pwas not observed in a similar set of experiments (datanot shown).The are1D are2D strain, as well as ... theamount of free unesterified sterols in membranes butalso the amount of sterols derived from SE that areTable 1. Sterol analysis of cells lacking STE20 and CLA4. Data are mean values with standard...
  • 12
  • 699
  • 0
Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

Tài liệu Báo cáo khoa học: Characterization of electrogenic bromosulfophthalein transport in carnation petal microsomes and its inhibition by antibodies against bilitranslocase docx

... Sigma-Aldrich and Carlo Erba (Milan, Italy), and were of the highest available grade.AcknowledgementsThanks are due to Prof G.L. Sottocasa and Dr Anto-nella Bandiera (University of Trieste) ... legitimate to apply theScrutton and Utter equation [40] to the inhibition data.Data analysesData were analysed by means of sigmaplot 2001 (SPSSScience Software Gmbh, Erkrath, Germany). Data for ... BSA and 20 mm Tris ⁄ HCl pH 7.5 at a final proteinconcentration of % 1mgÆmL)1.Marker enzyme assaysThe level of purification of tonoplast and plasma mem-brane vesicles was evaluated by measuring...
  • 15
  • 589
  • 0
Báo cáo khoa học: Regulation of arginase II by interferon regulatory factor 3 and the involvement of polyamines in the antiviral response potx

Báo cáo khoa học: Regulation of arginase II by interferon regulatory factor 3 and the involvement of polyamines in the antiviral response potx

... ArgII, 5¢-GATCTGCTGATTGGCAAGAGACAA-3¢ and 5¢-CTAAATTCTCACACGTGCTTGATT-3¢ [50], 362 bp; human and murine ArgI, 5¢-ATTGGCTTGAGAGACGTGGACCCT-3¢ and 5¢-TTGCAACTGCTGTGTTCACTGTTC-3¢, 369 bp;human ODC, ... -TGTTGCTGCTGCCTCTACGTT-3¢ and 5¢-GCTGGCATCCTGTTCCTCTACTT-3¢, 138 bp [51];human b-actin, 5¢-ACAATGAGCTGCTGGTGGCT-3¢ and 5¢-GATGGGCACAGTGTGGGTGA-3¢; murine b-actin,5¢-TGGAATCCTGTGGCATCCATGAAAC-3¢ and 5¢-TAAAACGCAGCTCAGTAACCGTCCG-3¢. ... the Canadian Institutes of Health Research and CANVAC, the Canadian Network for Vaccines and Immunotherapeutics. N.G. was supported by a post-doctoral FRSQ fellowship, J.Ha. and B.R.T. by anNSERC...
  • 12
  • 498
  • 0
Báo cáo khoa học: Induction of raft-like domains by a myristoylated NAP-22 peptide and its Tyr mutant potx

Báo cáo khoa học: Induction of raft-like domains by a myristoylated NAP-22 peptide and its Tyr mutant potx

... lipid rearrangementFEBS Journal 272 (2005) 1792–1803 ª 2005 FEBS 1803 Induction of raft-like domains by a myristoylated NAP-22 peptide and its Tyr mutant Raquel F. Epand1, Brian G. Sayer2 and ... spinning; NAP-22 peptide, the myristoylated amino terminal 19amino acids of NAP-22 (myristoyl-GGKLSKKKKGYNVNDEKAK-amide); NAP-22, neuronal axonal membrane protein, also referred to as brainacid ... targeting of myristoylated and palmitoyl-ated proteins. Biochim Biophys Acta 1451, 1–16.43 Gratzer WB (1970) Numerical values of the absorbances of the aromatic amino acids. In Handbook of Biochemis-try:...
  • 12
  • 369
  • 0
Tài liệu Báo cáo khoa học: ¨ Induction of Kruppel-like factor 4 by high-density lipoproteins promotes the expression of scavenger receptor class B type I pptx

Tài liệu Báo cáo khoa học: ¨ Induction of Kruppel-like factor 4 by high-density lipoproteins promotes the expression of scavenger receptor class B type I pptx

... siRNA; siR-NA, PMA-differentiated THP-1 macrophages were transiently trans-fected with siRNA of KLF4. The relative values of all results weredetermined and expressed as mean ± standard error of ... Moreover, it was shown thatligand activated peroxisome proliferator activatedreceptor increases SR-BI expression in human mono-cytes and macrophages [16]. As a transcriptional factor,many target ... CAG CCGTCC CAG TCA CAG TGG-3¢ (reverse); SR-BI, 5¢-CCTTCA ATG ACA ACG ACA CCG-3¢ (forward) and 5¢-CCATGC GAC TTG TCA GGC T-3 ¢ (reverse); glyceraldehyde-3-phosphate dehydrogenase, 5¢-GAC ATC...
  • 9
  • 516
  • 0
Tài liệu Báo cáo khoa học: Induction of uPA gene expression by the blockage of E-cadherin via Src- and Shc-dependent Erk signaling docx

Tài liệu Báo cáo khoa học: Induction of uPA gene expression by the blockage of E-cadherin via Src- and Shc-dependent Erk signaling docx

... that FAK plays a role in Decma-induced Erk activation. No interaction of Shc and FAK was detected upon Decma treatment and overexpression of dominant-negative FAK-relatednon-kinase (FRNK) failed ... GmbH (Basel, Switzer-land), SP600125 was obtained from Biomol (Wangen, Swit-zerland), and TPA, horseradish peroxidase-conjugatedantimouse and antirabbit antibodies, ECL reagent, protein A and ... and 5¢-CAUGUACCGAACCAAGUAGGA-3¢; control siRNA5¢-GUACCUGACUAGUCGCAGAAG-3¢ and 5¢-UCUGCGACUAGUCAGGUACGG-3¢. The specificities of thesesequences were confirmed by blasting against the Gen-Bank ⁄ EMBL database.Immunoprecipitation...
  • 14
  • 599
  • 0
Báo cáo khoa học: Modulation of glucocorticoid receptor-interacting protein 1 (GRIP1) transactivation and co-activation activities through its C-terminal repression and self-association domains pptx

Báo cáo khoa học: Modulation of glucocorticoid receptor-interacting protein 1 (GRIP1) transactivation and co-activation activities through its C-terminal repression and self-association domains pptx

... self-transactivation (AD1 and AD2) and co-activator (AR, ER and TR) functionsin HeLa cells. The outcome of the relationship betweenGRIP1 transactivation and co-activator functions var-ies according ... modulate its putative transacti-vation activities and nuclear receptor co-activator functions.AbbreviationsACTR, activator for thyroid hormone and retinoid receptors; AD, activation domain; AF, ... (GRIP1, also called TIF2), and activ-ator for thyroid hormone and retinoid receptors(ACTR) (also called RAC3, pCIP, AIB1 and TRAM1). These co-activators bind directly to theDNA-bound NRs and apparently...
  • 12
  • 424
  • 0
Báo cáo khoa học: Induction of PPARb and prostacyclin (PGI2) synthesis by Raf signaling: failure of PGI2 to activate PPARb potx

Báo cáo khoa học: Induction of PPARb and prostacyclin (PGI2) synthesis by Raf signaling: failure of PGI2 to activate PPARb potx

... 5¢—CCTTCTCCAACCTCTCCTAC—3¢;Cox-2 reverse, 5¢—AGGGGGTGCCAGTGATAGAG—3 ¢;PPARb forward, 5¢—AAGAGGAGAAAGAGGAAGTGG—3¢; PPARb reverse, 5¢—ATTGAGGAAGAGGCTGCTGA—3¢; actin forward, 5¢—GATGATGATATCGCCGCGCTCGTCGTC—3¢; ... forward, 5¢—CATAAGTTTACTGTTGTGGTTCTA—3¢; cPLA2 reverse, 5 ¢—AGTGTCTCGTTCGCTTCC—3¢; COX-2 forward, 5¢—CCATGGGTGTGAAGGGAAATAA—3¢; COX-2 reverse, 5¢—TTGAAAAACTGATGGGTGAAG—3¢; mPGES-1 forward,5¢—GGTGGCCCAGGAAGGAGACAGC—3¢; ... used: actin forward, 5¢—AGAGGGAAATCGTGCGTGAC—3¢; actin reverse, 5¢—CAATAGTGATGACCTGGCCGT—3¢; PPARb forward, 5¢—GTCGCACAACGCTATCC—3¢; PPARb reverse, 5¢—CTCCGGGCCTTCTTTTTGGTCA—3¢; cPLA2 forward,...
  • 10
  • 434
  • 0
Tài liệu Báo cáo khoa học: Plasticity of laccase generated by homeologous recombination in yeast docx

Tài liệu Báo cáo khoa học: Plasticity of laccase generated by homeologous recombination in yeast docx

... isolate a variant of a M. thermophila laccasecapable of resisting a wide array of co-solvents at con-centrations as high as 50% v ⁄ v [14]. In all availableexamples of molecular evolution of ... recombination assays. (A) Parental (lac1, lac2, lac3 and lac5) and hybrid (lac131, lac232 and lac535) sequences are represented by rectangles of variable lengths. Recombinant junctions are indicated by vertical ... purification and analysis of the pH activity profile allowed the charac-terization of a variant of laccase presenting unusualoxidation activity at pH 8 corresponding to a substan-tial increase...
  • 10
  • 585
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Evaluation of Machine Translations by Reading Comprehension Tests and Subjective Judgments" doc

... quality to a passage is a fairly complex task. We hoped that by asking subjects to judge sentences rather than passages, and to judge for clarity of meaning only, rather than quality generally, ... was avoided by random selection of the volume and page at which the search for each passage started. How- ever, in order to make up a satisfactory comprehension test, it was desirable to avoid ... decrease is just significant at the 0.05 level, according to the Friedman analysis of variance.* No practice effect is apparent for passages translated by humans. TABLE 2 Mean Number of Errors...
  • 7
  • 684
  • 1

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcchuyên đề điện xoay chiều theo dạngGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDENghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP