0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

... Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family Ste´phane Canaan1, Damien Maurin1, ... iscomposed of 7 parallel b strands associated to an anti-parallel strand (b2) and is surrounded by 5 helices (a1 , a2 , a3 , a7 anda8). T he second domain c onsists of helices a4 , a5 and a6 a ll clustered ... and a c harge r elayingaspartic (or glutamic) acid. To further investigate the biochemical characterization of the enzyme, we havetitrated these key residues that form the catalytic triad of Rv1399c. Catalytic...
  • 9
  • 584
  • 0
Báo cáo khoa học: Expression and characterization of the biofilm-related and carnosine-hydrolyzing aminoacylhistidine dipeptidase from Vibrio alginolyticus pot

Báo cáo khoa học: Expression and characterization of the biofilm-related and carnosine-hydrolyzing aminoacylhistidine dipeptidase from Vibrio alginolyticus pot

... binding ACTATTGATGAAGCCGCGGGCATGACAGGTGCD17 3A Zinc binding CCTTCTAAATACAGCTAGCGAACAAGAAGGCGH46 1A Zinc binding CCAACCATCAAGTTCCCTGCTAGCCCAGATGAG Characterization of V. alginolyticus PepD T Y. Wang ... CGCTCGGGGCAGCTAACGGCATCGGCATGGCD119X Zinc binding CGCTCGGGGCANNNAACGGCATCGGCATGGCE14 9A General base CTGACGATCGATGCAGAAGCAGGCATGACAGGE149X General base CTGACAATTGATNNNGAAGCAGGCATGACAGGE15 0A Zinc ... decays to the product after one additional proton transfer from the catalytic Glu149 carboxylate to the amide nitrogenin His219.On the other hand, although the results from ourmutational analysis...
  • 14
  • 303
  • 0
Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt

Báo cáo khoa học: Expression and characterization of recombinant 2¢,5¢-oligoadenylate synthetase from the marine sponge Geodia cydonium ppt

... discovered as a part of the interferon antiviral pathway in mammals [1,2]. Inhigher animals (vertebrates), when activated bydsRNA, 2- 5A synthetases catalyze the polymerization of ATP into unusual 2¢,5¢-linked ... optimal for the nuclease (high NaCl and phosphate concentrations and the absence of Mg2+).Another nuclease treatment was carried out afterpurification and dialysis of the recombinant protein (i.e. ... synthetasepreparations.RNA binding of the sponge recombinant 2- 5A synthetaseAll known vertebrate 2- 5A synthetases are known to be activated by their cofactor, dsRNA. Therefore, weperformed activity...
  • 13
  • 429
  • 0
Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx

... Fig. 7, panel A. Addition of ascorbate to the heme–Syn HO-1 complexcommences the reaction, which is monitored by the steadydecrease of the Soret and 498 nm bands and the shift of the band at 630 ... gauss isattributable to the 14N nuclei of the axial ligand trans to the nitrosyl ligand. This firmly establishes that the proximalligand of the heme–Syn HO-1 complex is a nitrogenous base. The ... the decrease of Soret band at 410 nm and to the increases of broad band spreading 600–700 nm. The latter band was confirmed to belong to biliverdin IX a by the HPLC analysis (data not shown).DiscussionOverall...
  • 12
  • 459
  • 0
Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

... Psaridi-Linardaki L, Trakas N, Mamalaki A & TzartosSJ (2005) Specific immunoadsorption of the autoantibo-dies from myasthenic patients using the extracellulardomain of the human muscle acetylcholine ... Tzartos SJ, Barkas T, Cung MT, Mamalaki A, Mar-raud M, Orlewski P, Papanastasiou D, Sakarellos C,Sakarellos-Daitsiotis M, Tsantili P, et al. (1998) Anat-omy of the antigenic structure of a ... amounts of the ECDs of the non -a sub-units of human muscle AChR for use as starting material for the determin-ation of the 3D structure of the receptor ECDs and for the characterization of the...
  • 12
  • 394
  • 0
Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

... and XhoIML2p A- chain5¢-GATATACATATGTACGAGCGTCTTCGTCTTCGTGTTACGCATC-3¢5¢-CACACCTCGAGTTATTAAGAAGAAGACGGACGGTCCCGGCATAC-3¢NdeI and XhoIML3p A- chain5¢-GATATACATATGTACCGTCGTATTAGCCTTCGTGTCACGGAT-3¢5¢-CACACGAATTCTTATTAAGAAGAAGAAGAACGGTCCCTGCATAC-3¢NdeI and EcoRIML3.1p A- chain5¢-GATATACATATGTACGAGCGTCTTCGTCTTCGTGTTACGCATC-3¢5¢-CACACGAATTCTTATTAAGAAGAAGAAGAACGGTCCCTGCATAC-3¢NdeI ... cloningML1p A- chain5¢-GATATACATATGTACGAGCGTCTTCGTCTTCGTGTTACGCATC-3¢5¢-CACACCTCGAGTTATTAAGAAGAAGACGGACGCTCACCGCA-3¢NdeI and XhoIML2p A- chain5¢-GATATACATATGTACGAGCGTCTTCGTCTTCGTGTTACGCATC-3¢5¢-CACACCTCGAGTTATTAAGAAGAAGACGGACGGTCCCGGCATAC-3¢NdeI ... (UTR)obtained by RACE. The sequences of the primers were:5¢AAAATCTAGAGAAGCAAGGAACAATGAATG-3¢(5¢UTR) containing the XbaI recognition site for cloning,5¢-AAAAATGCATGAAGTTGATTGCTTGCATTAACTCAT-3¢...
  • 11
  • 610
  • 0
Báo cáo khóa học: Isolation and characterization of the Xenopus HIVEP gene family ppt

Báo cáo khóa học: Isolation and characterization of the Xenopus HIVEP gene family ppt

... underlined: wt, 5¢-AGAGAGAATGAGAGGCTTCCCAATAGC-3¢;mut1,5¢-AGAGAGAATGATAGGCTTCACAATAGC-3¢;mut2,5¢-AGAGAGAATGATAGGCTTCCCAATAGC-3¢;mut3,5¢-AGAGAGAATGAGAGGCTTCACAATAGC-3¢.Binding reactions were ... derived from the additional sequence obtained in the first amplification(5¢-GARAAYTTYGARAAYCAYAARAARTTYTAYTG-3¢ and 5¢-AGTTCTAATGCTATGTTTGGATGC-3¢)affor-ded a product of 1.7 kb. Additional screening ... Primers and conditions used for RT-PCR were as follows: XHIVEP1,5¢-ATCCAGAGGCAGAAGCAG-3¢ and 5¢-CTGCATTCAGAGTAAGCC-3¢,60°C, 29 cycles; XHIVEP2,5¢-AAGCAGAGGAATGCAGTAG-3¢ and 5¢-AATGTCTTTCTCTCCATGG-3¢,60°C,...
  • 10
  • 414
  • 0
Báo cáo khoa học: Fatty acid regulation of adenylyl cyclase Rv2212 from Mycobacterium tuberculosis H37Rv doc

Báo cáo khoa học: Fatty acid regulation of adenylyl cyclase Rv2212 from Mycobacterium tuberculosis H37Rv doc

... active state(pH 6), the catalytic domains align as a closed dimercapable of binding ATP and of catalysis. In the in-active state (pH 8), the catalytic domains are drawnapart by extended a- helices ... mycobacterial class IIIb ACs, the HAMPdomains appear to directly act as modulators of ACactivity, possibly transmitting signals that may bepicked up by a receptor function of their hexahelicalmembrane ... pH-sensing isoform Rv1264, an N-terminalregulatory domain and a C-terminal catalytic domain. The maximal velo-city of Rv2212 was the highest of all 10 mycobacterial cyclases investigated to date (3.9...
  • 10
  • 257
  • 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

... cardiac fibrosis in a paracrine manner under ischaemic conditions.Taken together, these findings may improve understanding of the cellu-lar and molecular basis of the anti-inflammatory and paracrine ... transcription and secretion of IL-10Because of the lack of secretion of the inflammatorycytokines IL-1b and TNF -a from hypoxia ⁄ SD-stimu-lated MSCs, as well as the significant anti-inflamma-tory ... which may be an importantmediator of the cells’ paracrine anti-fibrotic effects.These findings help to improve our understanding of the cellular and molecular basis of MSCs’ anti-inflam-matory and...
  • 11
  • 653
  • 0
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

... in the Caryophyllaceae, Sambucaceae,Cucurbitaceae, Euphorbiaceae, Phytolaccaceae and Poaceae [1]. Although many are potentially useful inagriculture and medicine because of their antiviralproperties ... displayed hemagglutination and toxicitytoward mice (data not shown), additional efforts to cleanly isolate the isoform were not successful and further characterization was abandoned. A chromato-focusing ... chromatographies, and investigated withrespect to toxicity and sugar binding specificity. Half maximal inhibitoryconcentration and median lethal dose values indicate that P I and P II havesimilar...
  • 12
  • 763
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ