Báo cáo khoa học: Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli potx

... pro-pose a two- pathway electron transfer model for nitrate reductase A from Escherichia coli. Keywords: cytochrome b; electron transfer; Escherichia coli; nitrate reductase A; quinone. Nitrate can ... Evidence for two different electron transfer pathways in the same enzyme, nitrate reductase A from Escherichia coli Roger Giordani* and Jean BucLaboratoire de Chimie Bacte´rienne, Institut ... donorsand nitrate, in each case for several ranges of time(0.5–5 s). The traces obtained are shown in Fig. 4. Theyare monophasic and ﬁt a decreasing exponential equation. The amplitudes obtained...

$Tài liệu Báo cáo khoa học: Identiﬁcation of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line speciﬁcally binding to aptameric cytotoxic GT oligomers ppt$

Tài liệu Báo cáo khoa học: Identiﬁcation of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line speciﬁcally binding to aptameric cytotoxic GT oligomers ppt

... was then dried and auto-radiographed. In the UV cross-linking assay, the samples were incuba-ted at room temperature, as described above for the EMSAassay, and then irradiated at 302 nm for ... and incubated with mAb for eEF 1A, as described in the Materials and methods. Lane 1, bacterial recombinant eEF 1A protein(R eEF 1A) ; lane 2, eEF 1A protein from total nuclear extracts (NEeEF 1A) ; ... morphogenesis, a sixfold elevation in eEF 1A speciﬁc activity is accompanied by a dramaticincrease in protein methylation at as many as nine lysineresidues, without any change in the protein or mRNA levels[43]....

Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt

... indicates that the mechanism may be sim-ilar to that of Co2+. The fact that the equilibrium con-stants for the a domain are greater than those for the b domain may be a factor in explaining ... K 3a and K 4a for the a domain would have to be greater than K2band K3b for the b domain, to explain the observed ﬁlling of the a domain prior to that of the b domain.Although the metal-binding ... those for the b domain.Further interpretation of these data resulted in the proposal of positively cooperative metal binding as the primary metallation mechanism for each of the two domains [18–21]....

Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx

... gctttttggcaccaaagccctcggctccatcgg Lys24 to AlaL2 5A L2 5A F gctttttggcaccaaaaaggccggctccatcg Leu25 to AlaG3 3A G3 3A F ggttccgatcttgctgcgtcgatcaaagg Gly33 to AlaF3 9A F3 9A F gcgtcgatcaaaggcgctaaaaaagcaatgagcg ... AlaP2 6A P2 6A F cgcaacgactggctgtggcggtaaaaac Pro26 to AlaL6 3A L6 3A F ggagtttcaggacagtgcgaaaaaggttgaaaagg Leu63 to Ala2R > N R37N F gtagcgggctggattaacgcgttgaattcactggcg Arg37 and Arg40 to Asn3K ... ggcgtcatcggtggagggctttttggcaccaaaaag Val16, Val17 and Leu18 to GlyF2 0A F2 0A F catcgttgtactgcttgctggcaccaaaaagctc Phe20 to AlaG2 1A G2 1A F gttgtactgctttttgccaccaaaaagctcgg Gly21 to AlaK2 4A K24A...

Tài liệu Báo cáo khoa học: Evidence for proteasome dysfunction in cytotoxicity mediated by anti-Ras intracellular antibodies pdf

... colony forma-tion assay. Table 2 shows the percentage of G418-resistant colonies obtained by transfecting the establishedhuman tumor pancreatic carcinoma MIA PaCa 2 and the breast adenocarcinoma ... functions as a molecular switch in a large networkof signaling pathways [1]. Mutations in the ras gene havebeen identiﬁed in about 30% of all human cancers,indicating that this molecule is a preferential ... proteasomes from the total cellularenvironment to the huntingtin aggregates and to a higherrate of aggresome formation. Consequently, there is a decrease in proteasome availability for degrading...

Báo cáo khoa học: Evidence for the presence of ferritin in plant mitochondria pdf

... BAB64536) and AtFer1 and AtFer4 from A. thaliana. While it is clear that AtFer1 is a poorcandidate for a mitochondrial localization, for the otherproteins signiﬁcant scores were found. In particular,PSORTandIPSORTprograms ... mitochondria(Table 3). The data presented in this paper strongly indicate a mitochondrial localization for ferritins in P. sativum and A. thaliana and could be rationalized as follows: the proteinmay be ... proteinsand o f CMt and PMt from A. thaliana.Whentheseseparated proteins were subjected to cross-reaction withPAAF (Fig. 5B), a gain a band with an apparent molecularmass of 25– 26 kDa w as...

Báo cáo khoa học: Evidence for the slow reaction of hypoxia-inducible factor prolyl hydroxylase 2 with oxygen pptx

... a metal-to-ligandcharge transfer band at approximately 520 nm [27].Substrate binding adjacent to the Fe(II) is proposed toweaken binding of the remaining coordinated water,thus enabling the ... MJ, Padmakumar R & Hausinger RP (1999)Stopped-ﬂow kinetic analysis of Escherichia coli tau-rine ⁄ alpha-ketoglutarate dioxygenase: interactions withalpha-ketoglutarate, taurine, and oxygen. ... HIFregulation, asparaginyl hydroxylation (Asn803) in the HIF -a C-terminal transactivation domain reduces the interaction of HIF with transcriptional coactivators [8].HIF hydroxylation is catalysed...

Tài liệu Báo cáo khoa học: Identiﬁcation of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

... muta-genesis data therefore provide additional critical infor-mation over that obtained from X-ray data alone. The knowledge gained from these mutagenesis data will bevaluable in directing the ... and ACE2. The zinc prote-ase domain of both tACE and ACE2 is divided into two subdomains[20]. Subdomain I contains the zinc ion and the N-terminus. The C-terminus is found in subdomain II.tACE ... apparent that ACE2 is indeedboth structurally and functionally distinct from ACE. The extracellular domain structure of ACE2 wasdetermined in the native and the inhibitor-bound form[20]. The...

Báo cáo khoa học: Relationship between functional activity and protein stability in the presence of all classes of stabilizing osmolytes ppt

... (peptide backbone and sidechains) exposed on denaturation. For various osmo-lytes, Bolen & Baskakov [3] have shown that: (a) the main driving force for the folding is the unfavourableinteraction ... 1–12.24 Singh LR, Dar TA, Haque I, Anjum F, Moosavi-Movahedi AA & Ahmad F (2007) Testing the paradigmthat the denaturing effect of urea on protein stability isoffset by methylamines at the ... dimethyl-glycine have not been published elsewhere. We havetherefore measured the thermodynamic parameters ofRNase -A in the presence of these amino acids andamino acid derivatives, and values of...

Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

... ItalyTherapeutic strategies aimed at reducing brain dam-age after ischemic stroke have been a major focus ofacademic and industrial research for the past30 years. Two primary therapeutic approaches ... pro -in am-matory mediators is probably a result of the fact that in ammatory transcription factors such as nuclearfactor-kappaB, activator protein-1 and nuclear factorof activated T-cells are ... suggest that NMDA receptorchannel openings, ROS formation, DNA damage andPARP activation are sequential crucial steps in the process leading to neuronal death. They also indicatethat stroke...

Xem thêm