0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx

Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx

Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx

... Disruption < /b> of < /b> the < /b> interaction < /b> between < /b> the < /b> Rieske < /b> iron–sulfur < /b> protein< /b> and < /b> cytochrome< /b> b in the < /b> yeast bc1 complex owing to a human disease-associated mutation within cytochrome< /b> b Nicholas Fisher1, ... Studies of < /b> the < /b> mechanism of < /b> assembly of < /b> the < /b> bc1 complex suggest that the < /b> ISP is one of < /b> the < /b> lastsubunits to be integrated within the < /b> membrane-boundsubcomplex [2]. The < /b> integration of < /b> the < /b> ISP is facilitatedby ... discussed in greater detail below.Instability of < /b> the < /b> mutant enzymeFurther analysis of < /b> the < /b> kinetic parameters of < /b> the < /b> G167Emutant was hindered by rapid inhibition of < /b> the < /b> activity of< /b> the < /b> bc1complex...
  • 7
  • 498
  • 0
Báo cáo khoa học: Mechanism for transcriptional synergy between interferon regulatory factor (IRF)-3 and IRF-7 in activation of the interferon-b gene promoter docx

Báo cáo khoa học: Mechanism for transcriptional synergy between interferon regulatory factor (IRF)-3 and IRF-7 in activation of the interferon-b gene promoter docx

... in Fig. 1B suggest that in P19 cells (a pluripotential teratocar-cinoma line) the < /b> failure to activate the < /b> IFN -b promoter wasnot due to the < /b> absence of < /b> the < /b> pathway leading to activation of< /b> IRF-3 and < /b> ... ()66 to )55) (Fig. 1A) . VA Falso contains the < /b> coactivators p300 and < /b> CREB binding protein < /b> (CBP), which are thought to play a critical role in activation of < /b> the < /b> IFN -b promoter because interactions between < /b> ... followed b y two washes with binding buffer and < /b> twowashes with binding buffer without BSA. Proteins bound to the < /b> beads were eluted with SDS loading buffer and < /b> analyzedby SDS/PAGE, visualized by autoradiography...
  • 11
  • 487
  • 0
Tài liệu Báo cáo khoa học: Regulation of connective tissue growth factor (CTGF/CCN2) gene transcription and mRNA stability in smooth muscle cells Involvement of RhoA GTPase and p38 MAP kinase and sensitivity to actin dynamics docx

Tài liệu Báo cáo khoa học: Regulation of connective tissue growth factor (CTGF/CCN2) gene transcription and mRNA stability in smooth muscle cells Involvement of RhoA GTPase and p38 MAP kinase and sensitivity to actin dynamics docx

... stempting to speculate that interactions between < /b> monomericG-actin and < /b> actin-binding proteins are a potential target of< /b> regulation by RhoA GTPase.Furthermore, our data indicated that RhoA-mediatedCTGF/CCN2 ... mRNA can be used as a model of < /b> labile RNA to establish the < /b> potential role of < /b> the< /b> AREs and < /b> ARE-binding proteins and < /b> their significance forCTGF/CCN2 mRNA regulation b y the < /b> p38 pathway.Accordingly, ... vacuum transferred onto a Z-probe nylon membrane using a slot blot apparatus (Bio-Rad). The < /b> membran e was U V-irradiated and < /b> p rehybridizedas described above for northern blotting. Equal amounts...
  • 15
  • 576
  • 0
Báo cáo khoa học: Disruption of the gene encoding 3b-hydroxysterol D14-reductase (Tm7sf2) in mice does not impair cholesterol biosynthesis pdf

Báo cáo khoa học: Disruption of the gene encoding 3b-hydroxysterol D14-reductase (Tm7sf2) in mice does not impair cholesterol biosynthesis pdf

... interme-diates during the < /b> conversion of < /b> lanosterol to cholesterol. The < /b> C-terminaldomain of < /b> lamin B receptor, a protein < /b> of < /b> the < /b> inner nuclear membranemainly involved in heterochromatin organization, also ... anti- (human LBR) serum recognizes a protein < /b> band with an apparent molecular mass of< /b>  66 kDa. Equal amounts of < /b> proteins (50 lg) were loaded in each lane and < /b> checked by Ponceau staining of < /b> poly(vinylidene ... presence of < /b> the < /b> C27D8,14sterol substrate.Activity was measured on the < /b> basis of < /b> C27D8forma-tion and < /b> C27D8,14disappearance, evaluated as the < /b> peakarea ratio between < /b> the < /b> individual sterol and...
  • 14
  • 299
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "CONYEXR OF DIALOGUE INTERACTION" pdf

... represent the < /b> agents of < /b> the < /b> dialogue and < /b> the < /b> third one is a model of < /b> the < /b> world including the < /b> envirorm~_nt of < /b> interaction < /b> and < /b> other agents if they participate. The < /b> autcrnaton-agent is the < /b> central ... CA and < /b> the < /b> topic (CA can be initiating, continuing, closing and < /b> re-initiating in respect to its topic). A sub- sequence of < /b> coherent cL~municative acts connected with the < /b> sane topic is called ... notations. Let {M} be a set of < /b> all propositions reflecting the < /b> possible states of < /b> the < /b> three automata within the < /b> model, and < /b> M be a memory representing the < /b> agents' mutually coordinated beliefs...
  • 3
  • 255
  • 0
Báo cáo khoa học: Disruption of structural and functional integrity of a2-macroglobulin by cathepsin E pptx

Báo cáo khoa học: Disruption of structural and functional integrity of a2-macroglobulin by cathepsin E pptx

... rapidly dissociated at pH 3.8 within a 2-min incubation (Fig. 7B) . Parallel to this change, a significant amount of < /b> the < /b> original a2 M disappeared and < /b> a Table 1. The < /b> ability of < /b> cathepsin E and < /b> cathepsin ... hydrolyzing activity of < /b> cathepsin E and < /b> cathepsin D To assess the < /b> inhibitory capacity of < /b> a2 M from varioussources for cathepsin D and < /b> cathepsin E, we first purifiedbovine a2 M. The < /b> final preparation gave ... additional conformational change of < /b> a2 M and < /b> thereby abolish the < /b> ability of < /b> cathepsin D to bind a2 M.This study also described for the < /b> first time the < /b> cloning and < /b> sequencing of < /b> partial cDNA for bovine a2 M,...
  • 10
  • 315
  • 0
Báo cáo khoa học: Disruption of transport activity in a D93H mutant thiamine transporter 1, from a Rogers Syndrome family pdf

Báo cáo khoa học: Disruption of transport activity in a D93H mutant thiamine transporter 1, from a Rogers Syndrome family pdf

... treated with tunicamycindisplayed a similar lack of < /b> plasma membrane localization of< /b> the < /b> mutant transporter as well as a typical subcellularlocalization that was confined to the < /b> perinuclear ERmembrane ... Amino-acid alignment of < /b> the < /b> aspartate 93 in human THTR1with various members of < /b> the < /b> SLC19 family. The < /b> conserved aspartate 93is indicated in bold. Light shading indicates the < /b> amino acids showingconservation ... the < /b> innermost N-acetyl-D-glucosamine and < /b> theacceptorasparagine, thereby resulting in the < /b> complete removal of < /b> the < /b> N-glycan from glycosylatedproteins. Treatment of < /b> total cell extracts from transfectedcells...
  • 9
  • 480
  • 0
Tài liệu Báo cáo khoa học: Degradation of tropoelastin by matrix metalloproteinases – cleavage site specificities and release of matrikines pptx

Tài liệu Báo cáo khoa học: Degradation of tropoelastin by matrix metalloproteinases – cleavage site specificities and release of matrikines pptx

... the < /b> prodomain of < /b> MMP-9 and < /b> the < /b> bound peptide atMMP-12 show the < /b> same conserved hydrogen bonds between < /b> the < /b> substrate backbone atoms and < /b> the < /b> residues of< /b> the < /b> binding pocket, the < /b> prodomain interaction < /b> ... acid in tropoelastin and < /b> may alsobe in uenced by the < /b> amino acid at P1¢. As Ala and< /b> Gly constitute more than 50% of < /b> the < /b> tropoelastinsequence, it seems likely that the < /b> nature of < /b> the < /b> aminoacid ... met. Graphicalanalysis of < /b> the < /b> complexes was carried out using moe.Fibroblast culture and < /b> treatments Human skin fibroblast strains were established from ex-plants of < /b> human adult skin biopsy samples...
  • 18
  • 428
  • 0
Báo cáo khoa học: Design of expression vectors for RNA interference based on miRNAs and RNA splicing potx

Báo cáo khoa học: Design of expression vectors for RNA interference based on miRNAs and RNA splicing potx

... pmiR155 was generated by insertion of < /b> a pair of < /b> oligos, 5¢-tcgacttctagagctctggaggcttgctgaaggctgtatgctagagacgtacagatgcgtctcacaggacacaaggcc tgttactagcactcac atggaacaaatggccg-3¢, and < /b> 5¢-aattcggccatttgttccatgtgagtgctagtaacaggccttgtgtcctgtgagacg ... 5¢-aattcggcgctagctgctgatatcgcatacgcgtggaccagataggcacctattggtcttactgacatccactttgcctttctctccacaggtgtcg-3¢ and < /b> 5¢-gtaccgacacctgtggagagaaaggcaaagtggatgtcagtaagaccaataggtgcctatctggtccacgcgtatgcgatatcagcagctagcgccg-3¢, and < /b> pEGFP-N1cut by NdeI and < /b> Acc65I, to ... a pair of < /b> oligos, 5¢-tcgagaaggtatattgctgttgacagtgagcgagag acggaagccacagacgtctcatg cctactgcctcgg-3¢ and < /b> 5¢-aattccgaggcagtaggcatgagacgtctgtggcttccgtctctcgctcactgtcaacagcaatataccttc-3¢ into the...
  • 7
  • 514
  • 0
Báo cáo khoa học: Activity of matrix metalloproteinase-9 against native collagen types I and III potx

Báo cáo khoa học: Activity of matrix metalloproteinase-9 against native collagen types I and III potx

... H, Obata K, Yamada H, Hay-akawa T, Fujikawa K & Okada Y (2000) Matrix metal-loproteinases and < /b> tissue inhibitors of < /b> metalloproteinases in synovial fluids from patients with rheumatoid arthri-tis ... conversion of< /b> b 12dimers to a 1 and < /b> a 2monomers is apparent in thislane, to give an increased level of < /b> both the < /b> a chains and< /b> a slightly increased mobility of < /b> the < /b> a 2chain. This indi-cates the < /b> presence ... demonstrated by cleavage of < /b> denatured sub-strate (denat). The < /b> positions of < /b> the < /b> uncut collagen b and < /b> a chains (b 11, b 12, a 1 and < /b> a 2) are shown. Cleavage of < /b> wild-type and < /b> mutatedtype I collagen...
  • 10
  • 280
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngBT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ