0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot

Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot

Báo cáo khoa học: Purification and structural analysis of the novel glycoprotein allergen Cyn d 24, a pathogenesis-related protein PR-1, from Bermuda grass pollen pot

... Hordeum A. A.N N-QRIN LQ GG IFW AGAD ASDA.NS.VS D. D 113 Triticum G .A. S N-QRIN LQ GG IFW AGAD AADA.NA.VG D. D 113 Zea AYA.S A- QRQG LI GG FW AGAD.SASDA.GS.VS QY.DHDT.S. 112 Nicotiana AYA.N S-Q.AA ... GAG TCA GCC TCC CTC ACA ACA CCA 21673TTREEQPAAEAAASTAGGSQACC ACC AGG GAA GAA CAA CCG GCG GCA GAG GCC GCG GCG TCC ACC GCT GGC GGT AGC CAA 27693QEGYGSTQLPSDEPLNGLNDCAA GAA GGA TAT GGC AGC ACC ... cloned and characterized Cyn d 24 as a novel pathogenesis-related protein from BGP. Additionally, the identification of Cyn d 24 hasidentified the involvement of a novel class of PR pro-teins in pollen...
  • 10
  • 665
  • 0
Báo cáo khoa học: Purification and structural study of the b form of human cAMP-dependent protein kinase inhibitor pdf

Báo cáo khoa học: Purification and structural study of the b form of human cAMP-dependent protein kinase inhibitor pdf

... witholigonucleotides 5¢-CCCCATATGATGAGGACAGATTCATCAAAAATG-3¢ and 5¢-CATGGATCCTCATTTTTCTTCATTTTGAGGC-3¢. The amplified PCR fragmentwas inserted into plasmid vector pET between the endo-nuclease sites NdeIandHindIII. ... signal ATTAAA (1018–1023) and poly (A) tail (Fig. 1). The human PKIb protein predicted by the open reading frame is 78 amino acids inlength with a calculated molecular mass of 8468.2 Da and PI of ... bands, determined by band fitting of the absorbance spectrum of Fig. 4A, are shown in Fig. 6 and Table 2. From Table 2, the sum of individual amide I¢intensity and the intensity percent of each...
  • 6
  • 531
  • 0
Báo cáo khoa học: Purification and kinetic analysis of the two recombinant arogenate dehydrogenase isoforms of Arabidopsis thaliana pptx

Báo cáo khoa học: Purification and kinetic analysis of the two recombinant arogenate dehydrogenase isoforms of Arabidopsis thaliana pptx

... of the two A. thaliana arogenate dehydrogenases TyrAAT1 and TyrAAT2 deduced from their respective coding sequences (A) and alignment of amino acidsequence of the two protein domains of TyrAAT1 ... synthase and shiki-mate kinase, and not less than six for arogenatedehydratase. Analysis of the patterns of expression of the two A. thaliana arogenate dehydrogenases in differentorgans and in ... report the purification and detailed kinetic characterization of A. thaliana arogenatedehydrogenase. Both isoforms exhibit initial velocitypatterns in the absence and presence of products and dead...
  • 9
  • 429
  • 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... two additional residues, Leu and Val, at the C-terminus, which are cleaved duringmaturation.Fig. 2. cDNA and the deduced precursorsequence of conomarphin. The signal pep-tide is shadowed and ... shadowed and the mature peptide isunderlined. The polyA signal AATAAA in the 3¢-UTR is also underlined. The cDNA of con-omarphin has been deposited in the Gen-bank database with the accession ... chymotrypsin was used to digest natu-ral conomarphin and the synthetic peptide DWEY-HAHPKONSFWT. The cleaved fragments wereanalyzed on a C-18 HPLC column and were assignedon the basis of their relative...
  • 12
  • 616
  • 0
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... nucleotide and amino acid are indicated in the right of each row. The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A putative signal ... Relative positions of Hd1-DNA, Hd2-DNA, Hd5RACE-DNA, Hd3RACE-DNA, and HdFull-DNA are indicated as solid lines. Bold lines in both sides of the cDNAsindicateprimersusedforthePCR.LengthsofthecDNAsareshown ... protocol. Double-stranded cDNA was syn-thesized from the mRNA with a cDNA synthesis kit(TaKaRa, Tokyo, Japan) and used as an abalone cDNAlibrary. cDNAs encoding abalone cellulase were amplifiedby...
  • 8
  • 511
  • 0
Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx

Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx

... residue are indicated. (B) The assignments of the 1H-resonances of the GlcNAc and Gal II residues are indicated. The spectrum was recorded in D 2O at pH 7.0 and 295 K.4016 A. D. Cox et al. ... acceptor the sialylated tetrasaccharide unit cannot be attached. In strainRM118, and the RM118 lgtC mutant strain, we have nowidentified two different sialylated species, namely Sial-Lac and ... 4019Identification and structural characterization of a sialylatedlacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzaeAndrew D. Cox1, Derek W. Hood2, Adele Martin1,...
  • 11
  • 579
  • 0
Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc

Báo cáo khoa học: Purification and functional characterization of human 11b hydroxylase expressed in Escherichia coli doc

... PCRusing the 5¢-primer (CGCCATATGGCTACTAAAGCTGCTCGTGTTCCACGTACAGTGCTGCCA) and 3¢-primer(GCGAAGCTTAATGATGATGATGATGATGGTTGATGGCTCTGAAGGTGAGGAG) and inserted into the NdeI ⁄ HindIII-digested pET17b ... expression of AdR and Adx. The plasmid containing the coding sequence for AdRwas kindly provided by Y. Sagara [32]. Recombinant Adx and AdR were purified as described previously [33,34].Functional characterization ... absorption band [22]. Upon addition of substrate, the signal of the positive CD bandat 290 nm and the negative band at 386 nm decreased(Fig. 4B). A similar observation was described for sub-strate...
  • 12
  • 428
  • 0
Báo cáo khóa học: Purification and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt

Báo cáo khóa học: Purification and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt

... addition, the N-terminal and internal amino-acid sequences deduced from the cloned gene were the same as those determinedby Edman degradation. The recombinant protein expressed by E. coli waspurified ... degra-dation (data not shown). Another insecticidal protein wasalso purified from fraction ii. This protein migrated as a single band at a molecular mass of 34 kDa on electrophor-esis on SDS/10% ... toxin producedbyB. cereus The N-terminal and internal amino-acid sequences of the purified toxic protein were analyzed by Edman degrada-tion. The N-terminal amino-acid sequence was determined602...
  • 6
  • 456
  • 0
Báo cáo khoa học: Purification and partial characterization of seven glutathione S -transferase isoforms from the clam Ruditapes decussatus pptx

Báo cáo khoa học: Purification and partial characterization of seven glutathione S -transferase isoforms from the clam Ruditapes decussatus pptx

... collected from the lagoon of Thau (N.W.Mediterranean sea) and placed on ice for transport to the laboratory. They were then transferred to a 200-L aquariumfilled with natural aerated sea water, in a ... cross-reacted with antiserato pi and alpha classes and the isoform 5-5 cross-reacted with the antisera to mu and pi classes. Subunit 4 was recognizedby the three antisera used, and its N-terminal amino ... diluted 1 : 500 and a rabbit anti-(alpha class GST) (polyclonal antibody; Inter-chim) diluted 1 : 2000.RP-HPLCHPLC analysis of each of the four affinity fractions and of all the anion exchange...
  • 8
  • 338
  • 0
Báo cáo khoa học: Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) doc

Báo cáo khoa học: Identification and expression analysis of an IL-18 homologue and its alternatively spliced form in rainbow trout (Oncorhynchus mykiss) doc

... partial deletion of exon 2. However, this deletion did not disrupt protein translation and thus the alternative spliced mRNAremained in-frame and potentially translated into a 182amino acid ... cytokine.Materials and methodsCloning and sequencing of genomic DNA and cDNAAll products amplified by PCR were ligated into the pGEM-Teasy vector (Promega) and transformed intoTAM competent cells (ActiveMotif, ... sequences. (B) The two transcripts, IL-1 8A and IL-18B, resulting from the normal and the alternative splicing, and the deduced amino acid sequences.Table 2. Protein similarity and features of trout...
  • 11
  • 426
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM