Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... Hydrodynamic analyses of MutS aggregates
A single mismatch in the DNA induces enhanced
aggregation of MutS
Hydrodynamic analyses of the protein -DNA complexes
Nabanita Nag
1
, G. Krishnamoorthy
1
and Basuthkar ... underline).
Name Size (nt) Sequence
CLL 121 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAG
GTCGCG
ATTTCGACACAATTTATCAGGCGAG...
Báo cáo khoa học: A single mutation in Escherichia coli ribonuclease II inactivates the enzyme without affecting RNA binding pot
... important information
in the knowledge of RNase II proteins. To date, there
are no structural or mutational data available from any
other proteins of the family. The SK4803 strain is par-
ticularly ... indi-
cating that the loss of activity in the mutant protein
cannot be restored by increasing the Mg
2+
concentra-
tion.
RNA binding ability of RNase II and the D209N...
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... from a thermally unstable
one: frog, toad and newt DNases I all have a Ser205
insertion in a domain that contains an essential Ca
2+
-
binding site in the mammalian enzymes and are thermally
Fig. ... quadrivirgata
,
E. climacophora
and
A. blomhoffii
DNases I
Total RNA was isolated from each snake pancreas by the
acid guanidinium thiocyanate/phenol/chloroform method
[24] and any...
Báo cáo khoa học: A single EF-hand isolated from STIM1 forms dimer in the absence and presence of Ca2+ ppt
... Ca
2+
signal change and the accompa-
nying conformational change in the canonical EF-hand
are probably relayed to the SAM domain via the
paired ‘hidden’ EF-hand, resulting in the oligomeriza-
tion of ... the
insertion of the helix–loop–helix EF-hand domain
from STIM1, the helical content of the engineered
protein CD2.STIM1.EF increased, indicating that the
insert...
Báo cáo khóa học: A single mutation that causes phosphatidylglycerol deficiency impairs synthesis of photosystem II cores in Chlamydomonas reinhardtii pdf
... of the
psbA
mRNA is not affected
in the
mf2
strain
The dramatic decrease in D1 synthesis in mf1 and mf2 strains
did not correlate with any significant changes in the
accumulation of psbA mRNA, as ... C-3¢, and Acod (reverse): 5¢-CGC GGA TCC
ATG GAA TCG ATG TAT AAA CGG TTT TCA GTT
GAA GT-3¢,andtheEcoRI restriction fragment of the
chloroplast genome R14 [16] as a templa...
Báo cáo khoa học: A single intersubunit salt bridge affects oligomerization and catalytic activity in a bacterial quinone reductase pptx
... of the crystal structures indicates that the side chain of K109
plays a dual role by forming a salt bridge to D137, as well as stabilizing a
glycine-rich loop in the vicinity of the FMN cofactor. ... velocity measurements in
the presence of NADPH as the electron donor and
2-hydroxy-p-naphthoquinone as electron acceptor. The
family of parallel lines obtained f...
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
... [34]) as a standard. The amounts of chromatophores
and standard protein in the different lanes of a single gel
were kept in the linear range of the luminol assay response.
Light-induced ATP synthesis
Light-driven ... ates
obtained in the absence of a Du. In this case, the impairment
of the ATP synthesis rates in th e mutant was higher than
twofold, es...
Tài liệu Báo cáo khoa học: "A POOAFR MODIFICATIONS IN TEFRAIMOGSRP SLOHOML SFPG" potx
... restrictions gov-
erning the combination of features and values in
feature specifications; the definition of the
value range of a feature can thus be regarded as
another special case of cooccurrence ... recognition of the need for
explicit characterizations of the properties that
relate and distinguish similar grammar formalisms.
The paper proposes a series...
Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx
... demon-
strate a strong conservation in the binding of C-terminal binding protein-
interacting domains despite great variability in their amino acid sequences.
Finally, this L22 5A point mutation could also ... with the structural data
and the universal conservation of this residue in all C-terminal binding pro-
tein-interacting motifs, mutation of the central leucine re...
Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot
... For the detection of the unspliced
pgRNA and the SP1 splicing variant of HBV, primers SP1
(tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and
U2 (ttccaatgaggattaaagacag) were used.
Quantification ... mutagenesis (Stratagene, La
Jolla, CA, USA) using the proofreading DNA polymerase
KOD plus (Toyobo, Osaka, Japan). Deletion mutants are
indicated by a ‘D’ prefix and substitut...
Từ khóa:
- báo cáo khoa học
- báo cáo khoa học mẫu
- báo cáo khoa học y học
- báo cáo khoa học sinh học
- báo cáo khoa học nông nghiệp
- báo cáo khoa học lâm nghiệp
- báo cáo khoa học thủy sản
- báo cáo khoa học về cá tra
- báo cáo khoa học nghiên cứu chôm chôm
- trạng thái hiện sinh báo cáo khoa học
- biểu tượng văn học báo cáo khoa học
- tài liệu báo cáo khoa học
- cách trình bày báo cáo khoa học
- báo cáo khoa học toán học
- cách làm báo cáo khoa học
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế
- Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000
- Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)
- Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí
- Chuong 2 nhận dạng rui ro
- Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật