Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf

Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf

Báo cáo khoa học: NANOGP8 is a retrogene expressed in cancers pdf

... fibroblasts and human carci- noma tissues of the uterine cervix, breast and urinary bladder is shown. NANOGP8 was expressed in all of the human cancer tis- sues that were tested. NANOGP8 was not expressed ... resulted in only one amino acid change in the predicted protein sequence from (Gln, 757CAG) in Nanog and (His, 757CAC) in NANOGP8. Since NANOGP8 has an intact open-...
Ngày tải lên : 07/03/2014, 12:20
  • 8
  • 495
  • 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf

... Isolation, sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans. Antonie Leeuwenhoek 66, 111–127. 13 Kawasaki S, Arai H, Kodama T & ... is the His residue that in NirS is the proximal axial ligand to the d 1 heme. Replacement of an equivalent His, His41, in NirF by Ala abolished binding of the heme to the protein. Know...
Ngày tải lên : 15/02/2014, 01:20
  • 12
  • 613
  • 0
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx

... (AAC71532) and with the putative triacylglycerol lipase AAB96044 from Mycoplasma pneumoniae (Mp). Identical amino acids are indicated by an asterisk and similar amino acids are indi- cated by a colon and ... Woolford CA, Noble JA, Garman JD, Tam MF, Innis MA & Jones EW (1993) Phenotypic analysis of protein- ase A mutants. Implications for autoactivation and the maturation pathway of t...
Ngày tải lên : 07/03/2014, 05:20
  • 11
  • 568
  • 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx

... disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 was constructed to contain SUT2 as the only open reading frame present in the plasmid in ... 5¢-GACTGTCGATGATTATGGTTGCC CGCTGGCTTCCAAACCCTTATCGATACCGTCGA CCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACA GGAAAC...
Ngày tải lên : 07/03/2014, 15:20
  • 8
  • 485
  • 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

... Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT. All experimental protocols described in ... target genes. The data were deposited in GEO database GSE2043 (a complete list of these genes appears in Table S1 and a partial list is shown in Table 1). Because only a single...
Ngày tải lên : 07/03/2014, 17:20
  • 16
  • 476
  • 0
Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx

... 5¢-TAATTTAAAAGCCGTTGTATCCTTTGGT GAATCTT-3¢; C12 6A, 5¢-TAATTTAAAAGCCGTTGT AGCTTTTGGTGAATCTT-3¢; C126V, 5¢-TAATTTAAAA GCCGTTGTAGTTTTTGGTGAATCTT-3¢; C126M, 5¢-T AATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5¢; and ... site-specific mutagenesis – distal effects on dimer stability Moumita Samanta 1 , Mousumi Banerjee 1 , Mathur R. N. Murthy 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Bioph...
Ngày tải lên : 14/03/2014, 23:20
  • 12
  • 393
  • 0
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt

... transvacuolar strands and maintain overall cellular architecture. As mentioned above, CRP1 may participate in the formation and ⁄ or maintenance of long actin cables [12]. Consistent with this ... proteins and interacts with skeletal a- actin in the cytoplasm. However, little is known about the mechanism whereby hhLIM interacts with skeletal a- actin and regulates the organization and...
Ngày tải lên : 16/03/2014, 06:20
  • 11
  • 347
  • 0
Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot

Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot

... in amylin aggregation, inhibiting amylin aggregation in healthy individuals, but promoting aggregation during T2D pathogenesis. In summary, amylin–insulin inter- actions are most likely to play a complex ... concentrations of insulin. Taking amylin alone as a reference, after incu- bation for 6 h (Fig. 3A) , approximately half of the fibril formation was inhibited when amylin was inc...
Ngày tải lên : 23/03/2014, 04:21
  • 7
  • 388
  • 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

... Miyamoto K, Tanaka K, Kawai M, Tainaka K, Imada C, Okami Y & Inamori Y (1993) Cloning and sequence of an alkaline serine protease-encoding gene from the marine bacterium Alteromonas sp. strain O-7. ... standard. Standard enzyme assay SPRK activity was routinely measured using Suc-Ala-Ala- Pro-Phe-pNA (Sigma Aldrich) as substrate. The peptidase assay was carried out in a total volume o...
Ngày tải lên : 19/02/2014, 07:20
  • 14
  • 523
  • 0
Báo cáo khoa học: Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster doc

Báo cáo khoa học: Characterization of a functionally expressed dipeptidyl aminopeptidase III from Drosophila melanogaster doc

... proctolin (Arg-Tyr-Leu-Pro-Thr) have been compared to those of enkephalins. Indeed, a dipeptidyl aminopeptidase activity appears as one major proctolin- degrading peptidase, liberating the N-terminal ... degradation studies using proctolin (40 l M ) as the substrate. SDS/PAGE analysis of fractions contain- ing partially purified DPP activitiy revealed two major bands in the range of 82 and...
Ngày tải lên : 17/03/2014, 10:20
  • 9
  • 357
  • 0

Xem thêm

Từ khóa: