Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris,France): 5forGulox (forward), 5¢-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGATGACGACGACAAGATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3rev-Gulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3¢. ... 2006 The Authors Journal compilation ª 2006 FEBS 4445 Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase Beata A. Wolucka1and ... Vandekerckhove J, Van Montagu M,Zabeau M & Boerjan W (2001) Partial puriﬁcation andidentiﬁcation of GDP-mannose 3¢,5¢-epimerase of Ara-bidopsis thaliana, a key enzyme of the plant vitamin...

Báo cáo khoa học: Mycobacterium tuberculosis H37Rv ESAT-6–CFP-10 complex formation confers thermodynamic and biochemical stability docx

... the excess heat capacity vs. temperature thermogram of the sample. The baselines before and after transition were selec-ted for the thermogram with the origin 7.0 program, and the transition enthalpy, ... confers thermodynamic andbiochemical stabilityAkshaya K. Meher1, Naresh Chandra Bal1, Kandala V. R. Chary2and Ashish Arora11 Molecular and Structural Biology, Central Drug Research Institute, ... readilybe applied to characterization of the 11 other pairs of ESAT-6 family pro-teins and for screening ESAT-6 and CFP-10 mutants.AbbreviationsANS, 8-anilinonapthalene-1-sulfonate; CFP-10, 10-kDa...

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTTGACANNNNNNNNNNNNNNTGRTATAATNNNNAAGTAATAAAATATTCGGAGGAATTTTGAAATGAATAAACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk-back (5¢-CTCTACATGCATTTCAACAATAGGGCCTGTC-3¢) ... (5¢-TGGTACTCGAGCAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GGAAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) anddownstream to pyk using primer pyk3 (5¢-GGAAGGATCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4(5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) wereampliﬁed. ... minute. The relative values of simultaneous modulation of the three las enzymes are calculated as the average of the three individual relative activities.Construction of strains with modulatedexpression...

Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx

... translocation and transcriptional activation of MRTFs, and Rho activity is crucial for actindynamics. Kuwahara et al. [54] showed that the dominant-negative RhoA mutant inhibits the nuclearaccumulation ... MRTFs and SRF activity. Taken together, the small GTPase acts downstream of STARS, and itseems possible that ABLIM integrates signals from the small GTPases, Rac and RhoA (via STARS) toward the actin ... c-mycactivation, whereas Act3 ⁄ ARP4 and actin are compo-nents of the yeast Nu 4A HAT complex [38,42]. In the yeast Nu 4A HAT complex, actin and Act3 ⁄ ARP4 areessential for the structural integity...

Báo cáo Y học: Mycobacterium tuberculosis FprA, a novel bacterial NADPH-ferredoxin reductase docx

... isthat typical of a ﬂavoprotein with bands centered at 381 and452 nm and shoulders at 422 and 473 nm. Maximalabsorbance in the ultraviolet region was at 272 nm. A value of 7.0 for the A 272 /A 452ratio ... the fractional absorbance change at 452 nmas a function of dithionite/FAD molar ratio. A iand A fare the initialand ﬁnal values of absorbance at 452 nm, respectively.3008 F. Fischer et al. ... wideinvestigation of new targets for drugs against tuberculosis [2]. The disease has regained ground in the developed worlddue to the increased appearance of resistant strains of the bacterium and the...

Báo cáo khoa học: Mycobacterium tuberculosis ClpC1 Characterization and role of the N-terminal domain in its function ppt

... protein folding and degradation. ProcNatl Acad Sci USA 96, 11033–11040.16 Weibezahn J, Schlieker C, Bukau B & Mogk A (2003)Characterization of a trap mutant of the AAA+ chap-erone ClpB. ... Journal compilation ª 2008 FEBS Mycobacterium tuberculosis ClpC1Characterization and role of the N-terminal domain in its functionNarayani P. Kar, Deepa Sikriwal*, Parthasarathi Rath*, Rakesh ... prevent-ing the aggregation of luciferase and reactivatingheat-inactivated luciferase. Deletion of the N-terminalconserved repeat I (amino acids 1–38) resulted in analteration in the conformation and...

Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf

... covalent modiﬁcations of the enzyme, the effect of the inhibitor on the molecular mass value of HAD was measured; instead of an adduct increase, orno change, the value had unexpectedly decreased from22 ...  4 Da, the decrease of the molecular mass value. The most proba-ble reason for a 2 Da decrease is the formation of anS–S bond; although this was totally unexpected andunprecedented, the top-down ... the top-downapproach deserve consideration for important pro-teomics research.AcknowledgementsWe thank Barbara Baird, Ian Jardine, Neil Kelleher,Harold Scheraga and Klaas van Wyck for valuablediscussions,...

Báo cáo khoa học: Tumor necrosis factor-a converting enzyme is processed by proprotein-convertases to its mature form which is degraded upon phorbol ester stimulation pptx

... immature enzyme forms and black arrows the mature forms. (B) Quantitativeanalysis of mature TACE degradation by Western blot. The ratio of mature TACE to immature TACE was determined in the absence ... involved in a mechanism which decreases the amount of mature TACE (Fig. 5).Discussion The prodomain of the catalytically active members of the ADAM family is thought to act as an inhibitor of the proteinase ... pathways act as networks and aremutually inﬂuenced. Therefore we investigated the effect of a long-term PKA activation on mature TACE disappear-ance. Activation of PKA by dibutyryl-cAMP, a more stablecAMP...

Báo cáo khoa học: "Augmented Dependency Grammer: A Simple Interface between the Grammer Rule and the Knowledge" pptx

... in analysis and synthesis. It also explains the gap in semantics and logical meaning, and gives a clear computaional image of what we call conceptual analysis. This grammar is used for analysis ... FTABLE and THESAURUS Knowledge Base consists of LEXICON, THESAURUS and FTABLE. The case grammar, as a basis of internal representation, which is constructed with the combination of binary ... used for analysis of Japanese and synthesis of English, in the Japanese-to-English machine translation system called VEN~S (Vehicle for Natural Language Understanding and Synthesis) currently...

Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc

... necessary to raise the redox potential to a value that facilitates proper cataly-sis. On the other hand, there are also examples of proteins that normally do not contain a covalentﬂavin, but have ... activity wasmeasurable, it was clear that the microenvironmentaround the isoalloxazine moiety of the FAD analogcofactor was dramatically affected [89]. This showsthat even though, in many cases, ... MAO A [158] – Animal AMO 2BXRMAO B [159] – Animal AMO 1GOSAmadoriase I [54] – Fungus DAAO 3DJDMSOX [36] – Bacteria DAAO 2GB0Pipecolate oxidase [36] – Animal DAAO –N-methyltryptophan oxidase...

Xem thêm