0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

... The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex Rachel V. Dunn1, Ker R. Marshall2, Andrew ... Geneservices(Cambridge, UK) using the primers 5¢-GTCTTCGAA A CCATGGAGAATCAAGAGAAGGCGAGTATCGCGGG-3¢ and 5¢-GAGAGCTCGAGAACAGAACTTCAAGACCGTGGCAGGAGC-3¢. The NcoI and Xho I sites used forfurther cloning are ... 4048–4052.Supplementary material The following supplementary material is availableonline:Fig. S1. pH dependence of the steady-state kinetic parameters of MAO A- catalysed oxidation of benzyl- amine at 20...
  • 9
  • 327
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "You Can’t Beat Frequency (Unless You Use Linguistic Knowledge) – A Qualitative Evaluation of Association Measures for Collocation and Term Extraction" pot

... or associa-tion measures yield scores indicating to what de-gree a candidate qualifies as a term or a colloca-tion. While term mining and collocation mining,as a whole, involve almost the same ... Proceedings of the 39th Annual Meeting of the Association for Com-putational Linguistics and the 10th Conference of the European Chapter of the Association for Com-putational Linguistics, pages ... general-language parsers (in the case of CE).Therefore, most recent approaches in both areashave backed off to more shallow linguistic filter-ing techniques, such as POS tagging and phrasechunking...
  • 8
  • 435
  • 0
Báo cáo khoa học: Catalytic residues Lys197 and Arg199 ofBacillus subtilis phosphoribosyl diphosphate synthase Alanine-scanning mutagenesis of the flexible catalytic loop ppt

Báo cáo khoa học: Catalytic residues Lys197 and Arg199 ofBacillus subtilis phosphoribosyl diphosphate synthase Alanine-scanning mutagenesis of the flexible catalytic loop ppt

... 5¢-CGTCCGCGTGCAAACGTGG and 5¢-CCACGTTTGCACGCGGACG for P20 2A (pHO380), 5¢-CGCCGTCCGCGTCCAGCTGTGGCGGAAGTCATGAATATTGTAGGTAACATCGAAGGG and 5¢-CCCTTCGATGTTACCTACAATATTCATGACTTCCGCCACAGCTGGACGCGGACGGCG ... forN20 3A (pHO392), 5¢-CGCCGTCCGCGTCCAAACGCCGCGGAAGTCATGAATATTGTAGGTAACATCGAAGGGand 5¢-CCCTTCGATGTTACCTACAATATTCATGACTTCCGCGGCGTTTGGACGCGGACGGCG for V20 4A (pHO393), 5¢-CGTGGCGGCGGTCATGAATATTGTAGGand ... 5¢-CGTGGCGGCGGTCATGAATATTGTAGGand 5¢-CCTACAATATTCATGACCGCCGCCACG forE20 6A (pHO382), 5¢-CGTGGCGGAAGCGAGTAGG and5¢-CCTACAATATTCATCGCTTCCGCCACG for V20 7A (pHO383), and 5¢-CGTGGCGGAAGTCGCGAATATTGTAGG and 5¢-CCTACAATATTCGCGACTTCCGCCACGfor...
  • 9
  • 330
  • 0
Báo cáo khoa học: Nucleotide binding to human UMP-CMP kinase using fluorescent derivatives ) a screening based on affinity for the UMP-CMP binding site potx

Báo cáo khoa học: Nucleotide binding to human UMP-CMP kinase using fluorescent derivatives ) a screening based on affinity for the UMP-CMP binding site potx

... FranceHuman UMP-CMP kinase (UCK) plays a key role in the ribonucleoside and deoxyribonucleoside salvagepathway and in the anabolic phosphorylation of nucleo-side analogs used as antiviral and anticancer ... NMP kinase [2] and finally NDP kinase [3] and ⁄ orone of the enzymes capable of synthesizing ATP, suchas phosphoglycerate kinase [4,5], pyruvate kinase orcreatine kinase [6]. However, acyclic ... 2 Van Rompay AR, Johansson M & Karlsson A (2000)Substrate specificity and phosphorylation of nucleosidesand nucleoside analogs by mammalian nucleosidemonophosphate kinases. Pharmacol Ther...
  • 11
  • 468
  • 0
Báo cáo khoa học: Isoquinoline-1,3,4-trione and its derivatives attenuate b-amyloid-induced apoptosis of neuronal cells pdf

Báo cáo khoa học: Isoquinoline-1,3,4-trione and its derivatives attenuate b-amyloid-induced apoptosis of neuronal cells pdf

... caspasesand that the most promising caspase inhibitors tested in clinical trials are pan-caspase inhibitors, the abilityto inhibit most of the caspases is a desirable feature of isoquinoline-1,3,4-trione ... against Ab(25–35)-induced apoptosis by attenuating the activation of caspases and associated caspase cascades. Furtherstudy is in progress to verify their therapeutic effects in animal models of Alzheimer’s ... deter-mined by the Bradford method with BSA as the standard.Caspase-3 enzymatic assay and inhibition of catalytic activity The enzymatic activity of caspase-3 at 35 °C was deter-mined by measuring...
  • 11
  • 388
  • 0
Báo cáo khoa học

Báo cáo khoa học " ĐẶC ĐIỂM KỸ THUẬT TRONG THI CÔNG GIÀN MÁI KẾT CẤU THÉP KHẨU ĐỘ LỚN NHÀ THI ĐẤU THỂ DỤC THỂ THAO THÀNH PHỐ ĐÀ NẴNG " potx

... ph i hợp thử nghiệm nhiều lần và đã tìm ra được quy trình khắc ph c như sau: - Dùng giấy nhám thô v a ph i đánh sạch bề mặt bị châm kim; - Pha loãng sơn lớp 2, phun lớp mỏng lên bề mặt v a ... s a ch a các mặt bích hở 80mm ÷ 90mm là thay đoạn ống bị hụt bằng đoạn ống dài hơn (khi nối ống có lót ống bên trong). Giàn giáo ph c vụ s a ch a lắp dựng ở r a sàn thao tác. Theo đề xuất c a ... xảy ra bất kỳ sự cố nào), Kinh nghiệm rút ra là, các bên cần ph i thảo luận kỹ khi l a chọn biện ph p thi công vì biện ph p ph hợp làm cho công việc thi công ph c tạp trở nên đơn giản hơn, an...
  • 7
  • 1,668
  • 31
Báo cáo khoa học: Methylcitrate synthase from Aspergillus fumigatus Propionyl-CoA affects polyketide synthesis, growth and morphology of conidia ppt

Báo cáo khoa học: Methylcitrate synthase from Aspergillus fumigatus Propionyl-CoA affects polyketide synthesis, growth and morphology of conidia ppt

... environment and may play a role in the resistance against killing by alveolar macro-phages [23,27,28]. In contrast to that the white conidia of a pksP mutant strain posses a plain surface andseem ... generally contain large amounts of proteins wecan assume that a germinated A. fumigatus spore willuse these proteins as carbon source. In that case, the amino acids isoleucine, valine and methionine ... activating enzymes are intact, acetate is always the preferred substrate over propionate [3]. In order to investigate the activation of acetate andpropionate in A. fumigatus, activities of the...
  • 16
  • 325
  • 0
Tài liệu Báo cáo khoa học: Structure determination and biochemical studies on Bacillus stearothermophilus E53Q serine hydroxymethyltransferase and its complexes provide insights on function and enzyme memory doc

Tài liệu Báo cáo khoa học: Structure determination and biochemical studies on Bacillus stearothermophilus E53Q serine hydroxymethyltransferase and its complexes provide insights on function and enzyme memory doc

... by:FD¼ A A N =A A NWhere A Nis the absorbance of the protein sample at 30 °C, A Dis the absorbance of the sample at 80 °C and A Tis the absorbance of the protein sample at different ... cuvettes and equilibrated at 30 °C to obtain the baseline. The samples were heated from 30 °Cto90°Cat the rate of 1 °CÆmin)1using a programmable thermalcontrol unit. The absorbance change in each ... tetrahydrofolate.J Mol Biol 296, 155–168.12 Trivedi V, Gupta A, Jala VR, Saravanan P, Rao GS,Rao NA, Savithri HS & Subramanya HS (2002) Crystalstructure of binary and ternary complexes of...
  • 13
  • 514
  • 0
Tài liệu Báo cáo khoa học: Nop53p, an essential nucleolar protein that interacts with Nop17p and Nip7p, is required for pre-rRNA processing in Saccharomyces cerevisiae pdf

Tài liệu Báo cáo khoa học: Nop53p, an essential nucleolar protein that interacts with Nop17p and Nip7p, is required for pre-rRNA processing in Saccharomyces cerevisiae pdf

... eukaryotic translation and mRNA stability. A short upstream open reading frame strongly inhibitstranslational initiation and greatly accelerates mRNAdegradation in the yeast Saccharomyces cerevisiae.J ... pre-rRNA processing in Saccharomyces cerevisiaeDaniela C. Granato1, Fernando A. Gonzales1, Juliana S. Luz1, Fla´via Cassiola2,Glaucia M. Machado-Santelli2and Carla C. Oliveira11 Department ... [3H]uracil labeling.An aliquot of 20 lg of total RNA was loaded in each lane. The figures show autoradiographs of RNA transferred to nylon membranes incuba-ted in En3Hance (Amersham Biosciences)....
  • 14
  • 505
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Does Size Matter – How Much Data is Required to Train a REG Algorithm?" potx

... Domain complexity appears to be a factor in how much training data is needed: using Dice as anevaluation metric, training sets of 10 sufficed in the simple furniture domain, while in the more complex people ... REG challenges. For the sake of compari-son, we also follow the evaluation methodology of the REG challenges, training and testing on two do-mains (a furniture and a people domain), and usingtwo ... “semantically transparent” data sets of various sizes and evaluating on a held-out testset. The graph-based algorithm seems a good can-didate for this exercise, in view of its performance in the...
  • 5
  • 355
  • 0

Xem thêm

Từ khóa: tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdflam the nao de tom tat bao cáo khoa hocbáo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM