Báo cáo khoa học: Molecular basis of perinatal hypophosphata

Báo cáo khoa học: Molecular basis of perinatal hypophosphatasia with tissue-nonspeciﬁc alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain potx

... hypophosphatasia with tissue-nonspeciﬁc alkaline phosphatase bearing a conservative replacement of valine by alanine at position 406 Structural importance of the crown domain Natsuko Numa 1 , Yoko ... characterized by reduced serum alkaline phosphatase levels and defective mineralization of hard tis- sues. A replacement of valine wi...

Ngày tải lên : 07/03/2014, 05:20

11
500
0

Tài liệu Báo cáo khoa học: Molecular basis of glyphosate resistance – different approaches through protein engineering doc

... AMPA pathway), referred to as the GOX pathway. (B) Reaction catalyzed by GO on glyphosate, an alternative to the AMPA pathway as catalyzed by GOX. Mechanisms of glyphosate resistance L. Pollegioni et al. 2758 ... most glyphosate-resistant biotypes. In the case of Conyza canadensis, glyphosate accumulates in vacuoles of resistant plants at a markedly faster rate than in s...

Ngày tải lên : 14/02/2014, 14:20

14
793
0

Tài liệu Báo cáo khoa học: Molecular defect of isovaleryl-CoA dehydrogenase in the skunk mutant of silkworm, Bombyx mori ppt

... Koike Y, Nohata J, Kawasaki H, Kadono-Okuda K, Yamamoto K, Suzuki MG, Shimada T et al. (2003) The construction of an EST database for Bombyx mori and its application. Proc Natl Acad Sci USA 100, 14121– 14126. 27 ... Cleavage of structural proteins during assembly of head of bacteriophage-T4. Nature 227, 680–685. 31 Daimon T, Katsuma S, Iwanaga M, Kang W & Shimada T (2005) The...

Ngày tải lên : 18/02/2014, 04:20

12
631
0

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding speciﬁcity and target candidates doc

... 5¢-GAGCCAACAGAAGTTTGCT TCACACGTTGTTGAGAAATGTTT-3¢ (forward) and 5¢-GTCAAACATTTCTCAACAACGTGTGAAGCAAAC TTCTGTTGG-3¢ (reverse) to APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCAC CATGTTGCTACTGAATTTCTGCA-3¢ ... cucaucucuccuuacaguuuaccuguguaggaguuaggguucuuga auaaacaaugcaacaaagauuguagaagucag UGUACAUA At4 g36040 (1) Protein containing DNAJ domain;...

Ngày tải lên : 18/02/2014, 06:20

15
586
0

Tài liệu Báo cáo khoa học: Molecular cloning and characterization of soybean protein disulﬁde isomerase family proteins with nonclassic active center motifs pdf

... RT-PCR with a Thermal Cycler Dice Real Time System (TaKaRa Bio Inc.). Forward primers 5¢-CG TTTGAAGGGTGAGGAGGAAAA[FAM]G-3¢ and 5¢-CA CAAGAGAGTTCTGCGATAACCTTG[FAM]G-3¢ (Invi- trogen Corporation) and ... reverse primers 5¢-AAGTAGGCA ACAAAACAACG-3¢ and 5¢-GTTTTCCCGACAATAA- CATGG-3¢ were used for detecting GmPDIL- 3a and GmPDIL-3b, respectively. Primers for quantiﬁcation of actin mRNA were...

Ngày tải lên : 18/02/2014, 11:20

12
622
0

Tài liệu Báo cáo khoa học: Molecular and cellular speciﬁcity of post-translational aminoacyl isomerization in the crustacean hyperglycaemic hormone family docx

... (Table 3). Secondary antibodies (anti-rat IgG, anti-guinea pig IgG and anti-rabbit IgG; all raised in goat and conjugated to alkaline- phosphatase; Sigma, Saint Louis, MO, USA) were used at 1 : 2000 ... proﬁle of an acetic acid extract of 30 lobster sinus glands. Only the part of the chromatogram where CHHs and VIHs are eluted is shown. The nature of the ultraviolet absor...

Ngày tải lên : 18/02/2014, 11:20

13
687
0

Tài liệu Báo cáo khoa học: Molecular determinants of ligand speciﬁcity in family 11 carbohydrate binding modules – an NMR, X-ray crystallography and computational chemistry approach doc

... the Verlet leap- frog algorithm and the nonbonded interactions truncated with a 10 A ˚ cutoff. The temperature of the system was regulated by the Langevin thermostat to maintain the temperature ... carbohydrate conformation. Proc Natl Acad Sci U S A 98, 10541–10545. 35 Basma M, Sundara S, Calgan D, Venali T & Woods RJ (2001) Solvated ensemble averaging in the...

Ngày tải lên : 18/02/2014, 17:20

12
687
0

Tài liệu Báo cáo khoa học: Molecular aspects of rheumatoid arthritis: chemokines in the joints of patients pdf

... dependent on activation of the extracellular regulated kinase MAPK. The activation of MAPK is also important in regulating the RA FLS cytoskeletal structure and migration by fractalkine ⁄ CX3CL1 ... Immunolocalization analysis indicated that IP-10 ⁄ CXCL10 is associated mainly with inﬁltrating macrophage-like cells and ﬁbroblast-like cells in the RA synovium, and the inter...

Ngày tải lên : 18/02/2014, 18:20

8
652
0

Tài liệu Báo cáo khoa học: Molecular aspects of rheumatoid arthritis: role of environmental factors pdf

... factor-jB and extracellular signal-regulated kinase signaling cascades. In addition, AhR expression in synovial cells was upregulated by TNF -a. These data suggest that TNF -a activates AhR expression ... pregnancy are at the greatest risk of developing RA [45]. These researchers also suggested that the association among breastfeeding, pregnancy and RA may be related to either...

Ngày tải lên : 18/02/2014, 18:20

7
462
0

Tài liệu Báo cáo khoa học: Molecular aspects of rheumatoid arthritis: role of transcription factors ppt

... we also found that SAA stimulation promoted nuclear translocation of NF-jB, whereas pre-incubation of SAA with RAGE inhibited nuclear translocation [12]. These data suggested that SAA of RA joints ... colony-stimulating factor. RANKL activates the TNF receptor-associated factor 6, c-Fos, and calcium signaling pathways, all of which are indispensable for the induction and activa-...

Ngày tải lên : 18/02/2014, 18:20

8
520
0