Báo cáo khoa học: Recombinant bovine zona pellucida glycoproteins ZP3 and ZP4 coexpressed in Sf9 cells form a sperm-binding active hetero-complex ppt

... (lane 2 in each panel). The rZP3 and rZP3FLAGbands areindicated by arrowheads in (A) , (B), and (C). The rZP4 band is indi-cated by an arrow in (A) and (B). The ZP4 182)464band is indicatedby ... (C). Arrowheads indicate the recombinant protein bands. Molecular mass markers are indicated in kDa on the left of each panel.S. Kanai et al. Recombinant bovine zona pellucida glycoproteins FEBS ... rZP2, recombinant ZP2; rZP3, recombinant ZP3; rZP3FLAG, FLAG-tagged rZP3; rZP4, recombinant ZP4; rZP4FLAG, FLAG-tagged rZP4; rZPG, recombinant ZPG; ZP, zona pellucida; ZPG, zona pellucida glycoprotein.5390...

Tài liệu Báo cáo khoa học: Pyruvate reduces DNA damage during hypoxia and after reoxygenation in hepatocellular carcinoma cells pptx

... metabolism, and onstudying DNA damage. The metabolism of glutathione and DNA breaks were investigated in hepatocellularcarcinoma HepG2 cells cultivated with or withoutpyruvate during and after ... effects against hypoxia and reoxygenation. This is mainly ascribed to its ability tomaintain redox status [17], intervening in the DNArepair system [18–20] and restoring antioxidant capaci-ties ... involvesmodiﬁcations of glutathione metabolism. Glutathioneis an important intracellular antioxidant and redoxpotential regulator that plays a vital role in drugdetoxiﬁcation and in cellular protection...

Tài liệu Báo cáo khoa học: Roles of the human Rad51 L1 and L2 loops in DNA binding doc

... Consolidated Research Institute forAdvanced Science and Medical Care, Waseda Univer-sity.References1 Shinohara A, Ogawa H & Ogawa T (1992) Rad51 pro-tein involved in repair and recombination ... Enomoto R, Tanaka K,Miyagawa K, Shibata T, Kurumizaka H & Yokoyama S(2004) Structural basis for octameric ring formation and DNA interaction of the human homologous-pairingprotein Dmc1. Mol ... RecA protein uponDNA and cofactor binding. Eur J Biochem 217, 665–670.43 Kurumizaka H, Aihara H, Kagawa W, Shibata T &Yokoyama S (1999) Human Rad51 amino acid resi-dues required for Rad52...

Tài liệu Báo cáo khoa học: "Arabic Tokenization, Part-of-Speech Tagging and Morphological Disambiguation in One Fell Swoop" pdf

... output using the featuresgenerated by ALMORGEANA, the training data mustalso be in the ALMORGEANA output format. Toobtain this data, we needed to match data in theATB to the lexeme -and- feature ... data prepara-tion.We use the ALMORGEANA morphological ana-lyzer (Habash, 2005), a lexeme-based morphologi-cal generator and analyzer for Arabic.5 A sampleoutput of the morphological analyzer ... present an approach to using a mor-phological analyzer for tokenizing and morphologically tagging (including part-of-speech tagging) Arabic words in oneprocess. We learn classiﬁers for individualmorphological...

Báo cáo khóa học: Nerve growth factor mediates activation of the Smad pathway in PC12 cells doc

... Smad4-dependent. PC12 cells were transfected with Smad3, Smad4 or a functionallyinactive Smad4 variant – Smad4(DSAD) – either alone or in the indicated combinations. Smad4(DSAD) lacks aminoacids 274–321 ... functionalTrkA receptors and can be impaired by the inhibitorySmad7.Materials and methodsAntibodies and reagentsThe monoclonal antibody against TGF-b1, -b 2and- b3(clone #1D11) was purchased ... treatment triggers association of the Smadproteins within 30 min, indicating that NGF directlyactivates Smad signaling.NGF stimulation rapidly initiates nuclear accumulationof Smad3To assess...

Báo cáo khoa học: Probing the interface between factor Xa and tissue factor in the quaternary complex tissue factor–factor VIIa–factor Xa–tissue factor pathway inhibitor pptx

... Kdvalues for FVIIa binding toAEDANS-sTF were calculated (Table 1). These data showthat the AEDANS-sTF mutants maintained virtuallynormal binding to FVIIa and normal cofactor activity(Table ... to examine the impactof mutation and labeling of sTF on FVIIa binding and enhancement of FVIIa activity. The ability of theIAEDANS-labeled sTF variants to stimulate FVIIawas assessed and the ... spectra upon FXa binding In the sTF–FVIIa complex, positions 156, 163 and 166 in sTF are adjacent to the Gla domain of FVIIa, and positions200 and 201 are situated near EGF1 and the so-calledhydrophobic...

Báo cáo khoa học: "INTEGRATING TEACHING THE ENGLISH TENSE: NAIVE AND FORMAL GRAMMARS IN AN INTELLIGENT TUTOR FOR FOREIGN LANGUAGE TEACHING" pdf

... utilized in daily teaching. The relationship between formal and naive grammars in foreign language teaching is dealt with in this paper which presents, as a case study, an attempt to integrate ... • ~ • TEACHING THE ENGLISH TENSE: INTEGRATING NAIVE AND FORMAL GRAMMARS IN AN INTELLIGENT TUTOR FOR FOREIGN LANGUAGE TEACHING Danilo Fum 1, Bruno Pani 2 and Carlo Tasso 2 1 Dipartimento ... knowledge base for this module has been that of maintaining the wealth of ideas and intuitions existing in the naive account of tenses while developing at the same time a computationally tractable...

Báo cáo khoa học: Subcellular localization of yeast Sec14 homologues and their involvement in regulation of phospholipid turnover pptx

... ACATCTGAGTCTAGATATATACGTTTGTGTAGCGGGAAACGTTAAAAAAAAAAATCTTAATTATAGTTTATCGATGAATTCGAGCTCGTTTAAACKP1(SFH4) GCTCCACCCATCTCTATTGCKP2(SFH4)GGTCAATTTACCGTAAGTP1(SFH5) TGTCACAAATGTCCATCCAACAGAATACGGCCTTTACATTTTACAAAAACAAATCATCGAGGACGTTGAGGGAGCAGGTGCTGGTGCTGP2(SFH5) ... GGCATGTGGGTGAATTACAAR(SFH1-EGFP) GACGAGGCAAGCTAAACAGATP1(SFH2) AAACTACTCCAAGTTAGATCCGTACATCAGATCAAGATCCGTTTATGACTACAATGGTTCTCTAAAAGTTGGAGCAGGTGCTGGTGCTGP2(SFH2) AGGGACATATAAAGAAATAGATGTTTTTATAATAAAGGTCTATACAGTATGGAGCGTCGCGTGGCTTGGCTCGATGAATTCGAGCTCGTTTAAACKP1(SFH2) ... AAGTGAGGTTGATTTAAGAGGTACTCATGAAAAACTTCTTTACCCAGTAAAATCGGAAAGCAGTACCGTGGGAGCAGGTGCTGGTGCTGP2(SFH3) ATTAAACTTTTTATTCTCTTTTATTTATTATATATTATAGTGCATTATCATTATCTATCTAAATTTGCCTTCGATGAATTCGAGCTCGTTTAAACKP1(SFH3)...

Báo cáo khoa học: "Stochastic Language Generation Using WIDL-expressions and its Application in Machine Translation and Summarization" pot

... 3) in a summarization application that aims at producingboth informative and ﬂuent headlines. Our head-lines are generated in an abstractive, bottom-upmanner, starting from words and phrases. ... in a ﬁrst phase,symbolic knowledge to (over)generate a large setof candidate realizations, and, in a second phase,statistical knowledge about the target language(such as stochastic language ... results are presented in Table 1. We com-pare the performance of several extractive algo-rithms (which operate on an extracted sentenceto arrive at a headline) against several abstractivealgorithms...

Báo cáo khoa học: Deviation of the neurosporaxanthin pathway towards b-carotene biosynthesis in Fusarium fujikuroi by a point mutation in the phytoene desaturase gene ppt

... 5¢-TGGGCGAGCTCATGAGCGACATTAAGAAATCTG-3¢ and 5¢-CGCTCAGAACGACACCGTTTG-3¢, covering 11 bp upstream of the start codon and the ﬁrst 957 bp of the carB coding sequence, and 5¢-CGTTGAGGCACTGGTTAACG-3¢ and 5¢-CGAGAATCATGGACATAGAC-3¢, ... Car-BG-2F (5¢-TGGGCGAGCTCATGAGCGACATTAAGAAATCTG-3¢) and CarBG-3R (5¢-CGCTCAGAACGACACCGTTTG-3¢). The presence of the carB36 mutation waschecked using a FokI (Takara Shuzo, Kyoto, Japan) restrictionsite ... manufacturer’s instructions.Two microlitres of cDNA were used for the ampliﬁcation ofcarB using the primers 5¢-ATGAGCGACATTAAGAAATCTG-3¢ and 5¢-CTAATTCGCAGCAATGACAAG-3¢.The PCR was performed using 500...

Xem thêm

Từ khóa: chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thơ nôm tứ tuyệt trào phúng hồ xuân hương Chuong 2 nhận dạng rui ro Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ