0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Inactivating pentapeptide insertions in the fission yeast replication factor C subunit Rfc2 cluster near the ATP-binding site and arginine finger motif docx

Báo cáo khoa học: Inactivating pentapeptide insertions in the fission yeast replication factor C subunit Rfc2 cluster near the ATP-binding site and arginine finger motif docx

Báo cáo khoa học: Inactivating pentapeptide insertions in the fission yeast replication factor C subunit Rfc2 cluster near the ATP-binding site and arginine finger motif docx

... focus on the Rfc2 protein (alsoknown as RFC-D). Rfc2 binds ATP in site D at the Rfc2 Rfc5 (RFC-D–RFC-E) interface and contributesan arginine finger to site C at the Rfc3 Rfc2 (RFC -C RFC-D) interface. ... 2009 The Authors Journal compilation ª 2009 FEBS 4813 Inactivating pentapeptide insertions in the fission yeast replication factor C subunit Rfc2 cluster near the ATP-binding site and arginine finger ... Rfc4(RFC-B). The side chain of the arginine is referred toas an arginine finger and the finger protrudes into the ATP-binding site of the neighbouring subunit. The exact biochemical roles of the arginine...
  • 11
  • 502
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... their treatment decisions on the cow'scharacteristics. They focussed generally on the practicaluse of the score to support treatment of each individualcow, indicating that decisions can ... ('signif-icance testing'). Hence sources of variation and bias (pooraccuracy and precision) in centrally collected data files including unstructured human influence must berevealed, evaluated and ... owndefinitions of different scoring values, such as excludingcertain scores (see examples in table 1). They find the def-initions incorrect. If the veterinarian strictly follows his/her own scoring...
  • 10
  • 587
  • 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE6 5c- His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi et al. A novel isomerohydrolase in the retinaFEBS ... CTTTTGTGTAGGTGGGATTCG13cIMH GSP-FwdNM_001089433 CTGAGGTTACAGACAACTGTTC13cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCARPE6 5c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE6 5c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE65a-His-FwdNM_200751 ... GATATCTTATGGTTTGTACATCCCATGGAAAGRPE6 5c- FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE6 5c- Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE65a GSP-FwdNM_200751 TGGGGAGGACTTTTATGCTGTRPE65a GSP-Rev CTTTTGTGTAGGTGGGATTCG13cIMH...
  • 14
  • 753
  • 0
Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

... affect residues directly involved in ligandbinding, presumably abolishing the interaction withsignaling partners. The remaining mutations alteramino acids located outside the ligand-binding ... to the wider scienti c community. In the same year, the xid (X-linked immunodeficiency) mouse was recog-nized as a spontaneously occurring animal diseasemodel for inactivating mutations affecting ... T-cell kinase (ITK) could in uence the infectivity of HIV and also have anti -in ammatory activity. Since 2006, several patients carry-ing a fusion protein, originating from a translocation joining...
  • 10
  • 926
  • 0
Tài liệu Báo cáo khoa học: RMI1 deficiency in mice protects from diet and genetic-induced obesity pptx

Tài liệu Báo cáo khoa học: RMI1 deficiency in mice protects from diet and genetic-induced obesity pptx

... up-regulated in the liver and adipose tissue of KK-Aymice. RMI1 is a component of the Bloom’s syndrome gene helicase complex that maintains genome integrity and activates cell-cycle checkpoint machinery. ... (BLM)–topoisomerase complex [10]. Thiscomplex is essential for the maintenance of genomeintegrity, and can activate the cell-cycle checkpointmachinery [11,12]. Depletion of RMI1 by siRNA leadsto reduced cell ... molecules. We screened stock mouse embryonic stem cellsestablished using the exchangeable gene trap method, and examined the effects of deficiency of the target gene on diet and genetic-induced...
  • 10
  • 693
  • 0
Tài liệu Báo cáo khoa học: SREBPs: SREBP function in glia–neuron interactions pdf

Tài liệu Báo cáo khoa học: SREBPs: SREBP function in glia–neuron interactions pdf

... out-growth and increases synaptogenesis. Intriguingly,recent insights indicate that astrocytes may do this notonly via direct contact [36], but also via secretedfactors, which include fatty acids and ... synthesized by Schwann cells in the PNS, and by oligodendrocytes in the CNS. The electricalinsulating property of the myelin membrane is pro-vided by its high and characteristic lipid content.Although ... the control of insulin, glucose and fatty acids in severalcells types, among which are Schwann cells [1–3]. Acharacteristic of the SREBP transcription factors istheir post-translational activation...
  • 9
  • 711
  • 1
Tài liệu Báo cáo khoa học: Transcriptional upregulation of inflammatory cytokines in human intestinal epithelial cells following Vibrio cholerae infection pptx

Tài liệu Báo cáo khoa học: Transcriptional upregulation of inflammatory cytokines in human intestinal epithelial cells following Vibrio cholerae infection pptx

... in ammatoryresponse in intestinal epithelial cells, and the potentialcontribution of individual V. cholerae components tocytokine induction. The speci c components includelipopolysacccharide (LPS), any secreted ... observed in the nature of the cytokineexpression profile following V. cholerae infection in the ileocecal epithelial carcinoma cell line Caco-2 as com-pared to Int407 cells, derived from small intestine ... in Int407 cells than in T84 cells upon V. cholerae infection (Fig. 1A). The major cysteine–cysteine (C C) chemokine MCP-1showed upregulation in both Int407 (34-fold) and T84cells upon infection...
  • 12
  • 462
  • 0
Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

... plasticity and the promotion of cardiac protection in ischemia and ischemic preconditioning. J Mol Cell Cardiol 34, 1077–1089.8 Stanley WC (2004) Myocardial energy metabolismduring ischemia and the ... luciferase. The reaction of the luciferin ⁄ luciferase mixture, energydonor (ATP) and oxygen results in the emission of light. The intensity of the bioluminescence was detected using aluminometer, and ... the mitochondrial ATP concentration wasdetermined. Mitochondrial protein concentration was deter-mined [21], and a standard curve was constructed using1 · 10)5m to 1 · 10)9m ATP. The concentration...
  • 7
  • 582
  • 0
Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

Tài liệu Báo cáo khoa học: An intermediate step in the evolution of ATPases – a hybrid F0–V0 rotor in a bacterial Na+ F1F0 ATP synthase pdf

... recorded in the trace and retracedirections were observed, indicating that the scanning pro-cess did not in uence the appearance of the sample. Forimage processing, individual particles of the ... transferred into the system, and the c rings (partly) dissociated into singlesubunits and subcomplexes. The mass spectrum in Fig. 4B was used to determine the c 1to c 2 ⁄ 3stoichio-metry. The peak ... The C- terminal helices show a clear handedness, and twoof the rings face in the opposite direction in the membrane to the other two, forming the same patternas in the AFM surface representation...
  • 9
  • 773
  • 0
Tài liệu Báo cáo khoa học: Bone morphogenetic proteins in the early development of zebrafish pptx

Tài liệu Báo cáo khoa học: Bone morphogenetic proteins in the early development of zebrafish pptx

... Follistatin, Chordin and Noggin[12]. These proteins are antagonists of BMP and othermembers of the TGF-b family, binding to and inhibit-ing these signaling molecules from binding to theirreceptors ... enhancement of the Tld ⁄ BMP-1 medi-ated cleavage rate of Chordin, which may change the preference of site utilization; and (c) promotion of the dissociation of Chordin cysteine-rich (CR)-containingfragments ... in the BMP pathway probably will remain unresolved forsome time.Other factors affecting the BMPpathwayFactors inhibiting BMP2b, other than direct bindingproteins such as Noggin and Chordin,...
  • 8
  • 845
  • 0

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Chuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật