Báo cáo khoa học: Exosites mediate the anti-inﬂammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx

... compilation ª 2009 FEBS Exosites mediate the anti-inflammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus Pierre-Paul Prevot1, Alain Beschin2,3, Laurence Lins4,Je´roˆme ... Ixolaris, a novel recombinanttissue factor pathway inhibitor (TFPI) from the salivarygland of the tick, Ixodes scapularis: identification of fac-tor X and factor Xa as scaffolds for the inhibition of factor ... maintained and handledaccording to local and national ethical guidelines.Statistical analysisData are represented as means ± SD. The significance of the results was assessed using one-way ANOVA...

Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx

... USA 75,2315–2319.33. Yamashita, K., Ohkura, T., Tachibana, Y., Takasaki, S. &Kobata, A. (1984) Comparative study of the oligosaccharidesreleased from baby hamster kidney cells and their ... that of 4 by the presence of a 2-acetamide group adjacent to the p-nitro-phenyl group. This was the same in the case of a comparison of 1 and 3. Furthermore, the enzyme also catalysed a transglycosylation ... useful as a substrateinstead of keratan sulfate for analytical use in the endo-b-galactosidase assay. In addition, this similarity in the values of Vmax/Kmsuggests that the sulfate group on the 6-position...

Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"

... collection of the data in and of itself as the basis for taking relevant actionat the farm. They may skip the process of systematic anal-ysis of data and give advice based on their immediate eval-uation ... or her evaluation of the localcontext. That is, treatment data as an indicator of a certaindisease manifestation may only be valid within the herd.When veterinarians used standard treatment ... phenomena; 'scoring andrecording data on metritis' that relate to the quality of the data that are produced. We analyse and build &apos ;a model of understanding' based on DBL's...

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... black dots, protease cleavage sites. (B) SDS ⁄ PAGEseparation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose. (C) SDS ⁄ PAGE and silverstain ... identify the extracellular ligands of the RPTPs in the neuromuscular system. For example, it is knownthat PTPd and an isoform of LAR can interacthomophilically [39] and that LAR can also bindheterophilically ... of these wavelengths,separation of the fluorescent signals from the two fluoroph-ores was almost complete. A series of optical sections 1 lmapart were taken through a depth of 20 lm. All imageswere...

Báo cáo khoa học: Thermosynechoccus elongatus DpsA binds Zn(II) at a unique three histidine-containing ferroxidase center and utilizes O2 as iron oxidant with very high efﬁciency, unlike the typical Dps proteins ppt

... DpsA-Te1(5¢-GGAGTATCGTCATATGACGACCAGTGCATTG-3¢)and DpsA-Te2 (5¢-CAGACGACACAAAGCTTCACCTTG-3¢). The NdeI and HindIII restriction sites are under-lined. The ampliﬁed fragment (530 bp) was ... between the lastamino acid (valine) and the His-tag. Cleavage by factor Xaoccurs after an arginine, and the preferred cleavage site isAsp (or Glu or Ile)-Gly-Arg. Factor Xa was chosen as pro-tease ... Listeria innocua. Biochem J 338,71–75.32 Havukainen H, Haataja S, Kauko A, Pulliainen AT,Salminen A, Haikarainen T, Finne J & PapageorgiouAC (2008) Structural basis of the zinc- and terbium-mediated...

Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx

... Yamagami C, Takao N, Tanaka M, Horisaka K, AsadaS & Fujita T (1984) A quantitative structure–activitystudy of anticonvulsant phenylacetanilides. Chem PharmBull 32, 5003–5009.26 Birnbaum ... enzymatic reactions(GGT-catalyzed transpeptidation, and AGA-catalyzedand PGA-catalyzed hydrolysis), acylation is the rate-limiting step [16–18]. However, the values of q forScheme 1. PGA-catalyzed ... group of the aspartyl moietyin b-N-acetylglucosaminyl-l-asparagine has a similarfunction in the AGA-catalyzed hydrolysis [3]. Proba-bly, such additional stabilization by a protonatedamino...

Báo cáo khoa học: Catalytic residues Lys197 and Arg199 ofBacillus subtilis phosphoribosyl diphosphate synthase Alanine-scanning mutagenesis of the flexible catalytic loop ppt

... 5¢-CGCCGTCCGCGTCCAAACGCCGCGGAAGTCATGAATATTGTAGGTAACATCGAAGGGand 5¢-CCCTTCGATGTTACCTACAATATTCATGACTTCCGCGGCGTTTGGACGCGGACGGCG for V20 4A (pHO393), 5¢-CGTGGCGGCGGTCATGAATATTGTAGGand 5¢-CCTACAATATTCATGACCGCCGCCACG ... for P20 2A (pHO380), 5¢-CGCCGTCCGCGTCCAGCTGTGGCGGAAGTCATGAATATTGTAGGTAACATCGAAGGG and 5¢-CCCTTCGATGTTACCTACAATATTCATGACTTCCGCCACAGCTGGACGCGGACGGCG forN20 3A (pHO392), 5¢-CGCCGTCCGCGTCCAAACGCCGCGGAAGTCATGAATATTGTAGGTAACATCGAAGGGand ... 5¢-CCTACAATATTCATGACCGCCGCCACG forE20 6A (pHO382), 5¢-CGTGGCGGAAGCGAGTAGG and5¢-CCTACAATATTCATCGCTTCCGCCACG for V20 7A (pHO383), and 5¢-CGTGGCGGAAGTCGCGAATATTGTAGG and 5¢-CCTACAATATTCGCGACTTCCGCCACGfor M20 8A (pHO385)....

Báo cáo khoa học: Etoposide upregulates Bax-enhancing tumour necrosis factor-related apoptosis inducing ligand-mediated apoptosis in the human hepatocellular carcinoma cell line QGY-7703 pdf

... 5¢-CGGGATCCTCACTCCAAGGACACGGCA-3¢;DR5forward,5¢-CGGAATTCTGCAAGTCTTTACTGTGGAA-3¢; DR5 reverse, 5¢-CGGATCCTTAGGACATGGCAGAG-3¢;DcR2forward,5¢-CGGAATTCCGCGGAAGAAATTCATTTCT-3¢;DcR2 reverse, 5¢-CGGGATCCTCACAGGCAGGACGTAGCAG-3¢; Bax ... andProtein Analyser (Beckman Coulter). Two micrograms of total RNA was reverse transcribed using the TaKaRa OneStep RNA PCR kit (TaKaRa Bio Inc., Shiga, Japan)according to the manufacturer’s ... overbasal actin mRNA levels. The sequences of the primersused in this study are as follows: DR4 forward,5¢-CGGAATTCGGAGGGGACCCCAAGTGCAT-3¢;DR4 reverse, 5¢-CGGGATCCTCACTCCAAGGACACGGCA-3¢;DR5forward,5¢-CGGAATTCTGCAAGTCTTTACTGTGGAA-3¢;...

Tài liệu Báo cáo khoa học: 1,5-Diamino-2-pentyne is both a substrate and inactivator of plant copper amine oxidases ppt

... with an excess of GPAO (5 mg,added as a concentrated solution in the same buffer) and the mixture was incubated at 30 °C for 12 h. After that, the same amount of GPAO was added again and the ... decreased. Only a few amino acid side c hainsseem to be modiﬁed as a result of the reaction. A major part of DAPY oxidation product, aminopentynal, after the conjugate addition of an unreacted DAPY ... 1,5-diamino-2-pentyne(DAPY). The unsymmetrical DAPY comprises both a propargyl and homopropargyl amine.DAPY was synthesized and tested as a substrate of twoplant CAOs. DAPY acts as a mechanism-based inhibitor of the...

Tài liệu Báo cáo khoa học: "Discriminative Lexicon Adaptation for Improved Character Accuracy – A New Direction in Chinese Language Modeling" pptx

... from the relative increased character accuracy to the relat iveincreased MAP for the three lexicon adaptation ap-proaches are different. A key factor making the proposed LAICA approach advantageous ... parts randomly: 5K as the adaptation corpusand 5K as the testing set. We show the ASR char-acter accuracy results after lexicon adaptation by the proposed approach in Table 3.LAICA-1 LAICA-2 A ... edgeand also simplify the calculation of the weights of paths. This offers a tractable solution and the performance is quite acceptable.After we obtain the PPs for each character arcin the lattice,...

Xem thêm