0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... -FnBPB-1FnBPB-2/3FnBPB-4FnBPB-5FnBPB-6FnBPB-7FnBPB-8FnBPB-9FnBPB-10FnBPB-11GSTFnBRBFnBPB-1FnBPB-2/3FnBPB-4FnBPB-5FnBPB-6FnBPB-7FnBPB-8FnBPB-9FnBPB-10FnBPB-11GSTFnBRAFnBPA-1FnBPA-2FnBPA-3FnBPA-4FnBPA-5FnBPA-6FnBPA-7FnBPA-8FnBPA-9FnBPA-10FnBPA-11GSTFnBRA A< /b> 490 ... -FnBPB-1FnBPB-2/3FnBPB-4FnBPB-5FnBPB-6FnBPB-7FnBPB-8FnBPB-9FnBPB-10FnBPB-11GSTFnBRBFnBPB-1FnBPB-2/3FnBPB-4FnBPB-5FnBPB-6FnBPB-7FnBPB-8FnBPB-9FnBPB-10FnBPB-11GSTFnBRAFnBPA-1FnBPA-2FnBPA-3FnBPA-4FnBPA-5FnBPA-6FnBPA-7FnBPA-8FnBPA-9FnBPA-10FnBPA-11GSTFnBRA A< /b> 490 ... Journal compilation ª 2010 FEBS Monoclonal < /b> antibodies against < /b> FnBRs of < /b> FnBPB A < /b> panel of < /b> mouse mAbs was produced against < /b> the< /b> recombinant repetitive < /b> region < /b> of < /b> FnBPB. Analysis < /b> of< /b> mAbs binding to the...
  • 16
  • 560
  • 0
Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

Tài liệu Báo cáo khoa học: Functional analysis of the basic helix-loop-helix transcription factor DEC1 in circadian regulation ppt

... CAGCAGGATCCTCTAGAGAGTTTAGTCTTTG-3¢)anda5¢-terminus primer (one of < /b> 5¢-AAGCTTCACCATGTACCCTGCCCACATGTACCAAGTGTAC-3¢,5¢-AAGCTTCACCATGCCGCACCGG CTCATCGAGAAAAAGAG-3¢,5¢-AAGCTTCACCATGGCAGTGGTTCTTGAACTTACCTTGAAGC-3¢ ... ¢-AAGCTTCACCATGGAGCGGATCCCCAGCGCGCAACCAC-3¢)anda3¢-terminus primer (one of < /b> 5 ¢-TCTAGACTAGGAGCTGATCAGGTCACTGCTAGTGAAATGG-3¢,5¢-TCTAGACTACCCACTCGAGTGAGCGAAAGTCCGCTGG-3¢ or 5¢-TCTAGACTATTGACCTGTTTCGACATTTCTCCCTGACAGCTC-3¢)wereusedfor ... FLAG-taggedDEC1:2–412 and < /b> BMAL1, two sets of < /b> primers ( 5¢-AAGCTTGAGCGGATCCCCAGCGCGCAACCACC-3¢ and< /b> 5¢-GCAGCAGGATCCTCTAGAGAGTTTAGTCTTTG-3¢ for FLAG-DEC1; and < /b> 5 ¢-GAATTCGGCGGACCAGAGAATGGACATTTCCTCAACCATC-3¢...
  • 11
  • 629
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk(5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTTGACANNNNNNNNNNNNNNTGRTATAATNNNNAAGTAATAAAATATTCGGAGGAATTTTGAAATGAATAAACGTGTAAAAATCG-3¢)(N¼ A,< /b> T, G, C) and < /b> pyk-back (5¢-CTCTACATGCATTTCAACAATAGGGCCTGTC-3¢) ... (5¢-TGGTACTCGAGCAATTTCTGAAGGTATCGAAG-3¢) and < /b> pyk2 (5¢-GGAAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and< /b> downstream to pyk using primer pyk3 (5¢-GGAAGGATCCTTTGTCAATTAATGATCTTAAAAC-3¢) and < /b> pyk4(5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) wereamplified. ... equalamounts of < /b> formate and < /b> acetyl-CoA and < /b> the < /b> resultingacetyl-CoA is then metabolized into equal amount of< /b> ethanol and < /b> acetate to maintain the < /b> redox balance.DiscussionIn this study we quantified...
  • 12
  • 616
  • 0
Báo cáo khoa học: Functional analysis of mutations in UDP-galactose-4epimerase (GALE) associated with galactosemia in Korean patients using mammalian GALE-null cells pdf

Báo cáo khoa học: Functional analysis of mutations in UDP-galactose-4epimerase (GALE) associated with galactosemia in Korean patients using mammalian GALE-null cells pdf

... UDP-galactose as sub-strate. Enzyme activity was normalized against < /b> the < /b> relative protein< /b> abundance calculated from the < /b> intensities of < /b> myc–GALE and < /b> tubulinbands in the < /b> western blot. A < /b> representative ... supernatant wasresolved by SDS ⁄ PAGE and < /b> myc–GALE and < /b> EGFP pro-teins were detected by western analysis < /b> using antibody< /b> against < /b> myc (9E10; Santa Cruz Biotechnology, Santa Cruz,CA, USA) and < /b> antibody < /b> ... using antibodies against < /b> myc and < /b> GFP by western analysis.< /b> (B) Equalamount of < /b> total RNA prepared from transfected cells was reverse transcribed and < /b> 1 or 3 lL of < /b> cDNA was used to amplify EGFP and< /b> myc–GALE....
  • 10
  • 511
  • 0
Báo cáo khoa học: Functional analysis of disease-causing mutations in human galactokinase potx

Báo cáo khoa học: Functional analysis of disease-causing mutations in human galactokinase potx

... act as catalytic base [9]. However, the < /b> active site of < /b> homoserine kinase has no residues capable of < /b> acting as a< /b> catalytic base [7] and < /b> catalysis is believed to be driventhrough the < /b> stabilization ... of < /b> the < /b> metabolic control of < /b> flux through the < /b> Leloirpathway. Analysis < /b> of < /b> the < /b> galactokinase, its mutants, and < /b> the< /b> other enzymes of < /b> the < /b> metabolic pathway using the < /b> principles of < /b> a < /b> quantitative framework, ... nMwith the < /b> mutants).All data were analyzed by nonlinear curve fitting [27]using the < /b> program GraphPad Prism (GraphPad SoftwareInc.). Rates of < /b> reaction were obtained by fitting the< /b> absorbance data...
  • 8
  • 414
  • 0
Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt

... The < /b> absence of < /b> additional bands in the < /b> westernblot indicates that at least in COS-7 cells only the < /b> firststart codon (Table 1) is used.As the < /b> Hu-K4 mRNA is most abundant in brain and < /b> since the < /b> ... the< /b> membranes of < /b> intracellular organelles although theylack a < /b> transmembrane domain. They are attached to the < /b> cytoplasmic face of < /b> the < /b> membranes via palmitoylanchors [15] as is the < /b> vaccinia virus protein < /b> ... mRNA seems to be the < /b> same in all EST clones. The < /b> poly (A)< /b> tail starts about 300 nucleotides behind the < /b> stop codon. Two putative polyadenylation signals(AATAAG and < /b> AATAAC) are present about 20nucleotides...
  • 9
  • 518
  • 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... development and < /b> use of< /b> N-acylsulfonamides and < /b> sulfonimides as antagonists of < /b> nucleic acid-bindingproteins.DatabaseStructural data for the < /b> two RNase A < /b> complexes are available in the < /b> Protein < /b> Data Bank ... began by determining the < /b> ability of < /b> three backboneanalogs of < /b> RNA to inhibit catalysis by RNase A.< /b> These analogs have a < /b> simple polyanionic backbonewith neither a < /b> ribose moiety nor a < /b> nucleobase ... catalyzing the < /b> cleavage of < /b> RNA, RNases operateat the < /b> crossroads of < /b> transcription and < /b> translation.Bovine pancreatic RNase A < /b> (EC 3.1.27.5) is the < /b> bestcharacterized RNase. A < /b> notoriously stable...
  • 9
  • 626
  • 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

... cellular model of < /b> Parkinson’s disease pathogenesisTiziana Alberio1, Alessandra Maria Bossi2, Alberto Milli2, Elisa Parma1, Marzia Bruna Gariboldi1,Giovanna Tosi3, Leonardo Lopiano4 and < /b> ... 4. Activation of < /b> the < /b> NF-jB pathway. (A)< /b> NF-jB activity mea-sured by luciferase gene reporter assay after 24 h dopamine treat-ment (DA) relative to b- gal cells treated with catalase (b- gal cat, ... proteins grouped as above (Tables S2 and < /b> S3).In both cases, bioinformatic analysis < /b> revealed that the < /b> NF-jB pathway could be involved in determining the < /b> effects of < /b> dopamine treatment and < /b> a-< /b> synucleinoverexpression....
  • 11
  • 775
  • 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... LB400 through a < /b> PCR with GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA and < /b> GAGCGGCATATGGAAATCAAACCGAAGGTTCGCGA as the < /b> forward and < /b> reverse oligonucleotide primers, respectively. The< /b> primers were designed ... dissolved O2. HPLC analysis< /b> of < /b> the < /b> products of < /b> the < /b> enzymatic transformationrevealed that Bxe _A2< /b> 876 catalyzed breakdown of < /b> the< /b> b- diketone substrate via oxidative carbon–carbon bondcleavage to yield ... metal and < /b> substraterevealed that the < /b> Fe2+form of < /b> Bxe _A2< /b> 876 was anefficient catalyst of < /b> carbon–carbon bond cleavage in b- diketone substrates. X-ray absorption spectroscopy(XAS) was used to examine...
  • 15
  • 624
  • 0
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf

Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf

... fraction of < /b> the < /b> total amount of < /b> PAI-1 forming a < /b> stable complex with uPA, was calculated from the < /b> amount of < /b> PAI-1 required to inhibit half the < /b> uPA. The < /b> half-life of< /b> PAI-1 was finally calculated from ... percentage of < /b> the < /b> theoretical maximum. The < /b> activity was monitored over time and < /b> the < /b> rate of < /b> latencytransition expressed as the < /b> functional < /b> half-life, t½. The < /b> averages and < /b> standard deviations for at ... (Table 3). This advocates that the < /b> contact between the < /b> E285 side chain and < /b> the < /b> hF/s 3A-< /b> loop contributes to the < /b> functional < /b> stability of < /b> PAI-1stab and < /b> that a < /b> similar contact isnot present in the...
  • 9
  • 605
  • 0

Xem thêm

Từ khóa: báo cáo khoa họcbáo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họcBáo cáo quy trình mua hàng CT CP Công Nghệ NPVđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ