MONETARY TRANSMISSION MECHANISM: A VIEW FROM A HIGH INFLATIONARY ENVIRONMENT pdf

... MONETARY TRANSMISSION MECHANISM: A VIEW FROM A HIGH INFLATIONARY ENVIRONMENT Gülbin ŞAHİNBEYOĞLU RESEARCH DEPARTMENT Discussion Paper No: 2001/1 ANKARA January, ... exchange rate and interest rate which are available at a high frequency and set in their anticipation of future inflation. In the framework of the model, inflationary expectations are assumed ... disinflationary programmes led agents to form their expectations based on timely data such as changes in interest rates and the exchange rate. Additionally, the Central Bank’s actions allowing a...

A visit from a pen pal

... Their yard is separated from the factory by a tall fence. (Sân nhà họ được ngăn cách với nhà máy bằng một hàng rào cao.) -» separate (adj): riêng biệt; khác nhau —» separation (n): sự chia tách; ... www.videobook.vn UNIT 1: A VISIT FROM A PEN PAL (Chuyến viếng thăm c a một người bạn qua thư) 1. Vocabulary pen pal (n): bạn qua thư (ch a gặp mặt) to correspond (v) (with sb): trao đổi thư từ Ex: ... chia lớp thành những nhóm nhỏ.) -> division (n): sự phân chia; phép chia region (n): vùng; miền -» regional (adj): thuộc một vùng; đ a phương to separate (v): ngăn cách; tách ra; chia ra...

5
1,665
0

Unit 1: A visit from a pen pal

... students will be able to use past simple, andpast simple with wishII. Language contents:1. Grammar : 2. Vocabulary :III. Techniques : Eliciting questions, asks and answersIV. Teaching aids : Textbook, ... ask and answer questions about what Ba, Nga, Lan, Nam and Hoa did on the weekend ( exercis1/ P 11)+Tell them that the activities happenedin definite in the past.+ Let students practice in ... conversation between Tan and Phong. They are talking about Ba did on the weekend.+ Give the modelForm :VERB + ED or PAST FORM OF IRREGULAR VERB ( V2 )+Ask students to work in pairs to ask and...

2
1,081
0

Unit 1: A visit from a pen pal

... Remember+ Call some students go to the board and write down.+ Lan’s Malaysian pen pal came to visit her in Hanoi . Can you guess where she went and what she did during her stay ?+ Ask students ... Date of teaching : September 13th , 2007UNIT 1 : A VISIT FROM A PEN PALLESSON 1 : GETTING STARTED & LISTEN AND READLANGUAGE FOCUS 3I. Objectives :_ To introduce the topic and new material_ ... material_ By the end of the lesson, students will be able to know about places Lan went to with her foreign friends and activities they took part in.II. Language contents :1. Grammar :+ The past...

Unit 1_ A visit from a penpal

... places they visited.Answer these Qs.Created by TTM_titiempiMalaysia Viet NamArea PopulationCapital cityClimateUnit of currencyOfficial religion( & others)National languageCompulsory ... its Arabic name, masjid Arabic.Date: ____________Name: _____________________ English 9_ Unit 1Fill in each blank with one suitable word:1. Japan _________________four main islands Hokkaido, ... her pen-pal, Maryam started corresponding over two years ago.Lan & her pen-pal, Maryam have _________________________________ two years.Created by TTM_titiempiDate: ____________Name: _____________________...

Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

... ReferenceMF gacccgatgttcaagatact Saito et al., 2003bMR ctcctcccacaaatcaggacQMF agacgcacgctcacctcaa in this studyQMR gagcagttcacgaaatccQMT (Probe) atacgctcttactgtttccggccgccBACT1369F cggtgaatacgttcycgg ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura. Environ.Tech., 14, 433-442. Park H D., Iwami C., Watanabe M. F., Harada K I., Okino T. and Hayashi H. (1998). Temporal ... ctcctcccacaaatcaggacQMF agacgcacgctcacctcaa in this studyQMR gagcagttcacgaaatccQMT (Probe) atacgctcttactgtttccggccgccBACT1369F cggtgaatacgttcycgg Suzuki et al., 2000PROK1492R ggwtaccttgttacgacttTM1389BACT2...

unit 1: A visit from a penpal- t3,t4

... the passage by showing the map and the picture about Malaysia.- T asks “What do you know about Malaysia.- T asks sts to read the passage silently and underline the new words.- T explains ... new word (translation method)- T reads the passage and students listen and find the right information about Malaysia to fill in the table. (pair word)- T hangs a cardboard and gets sts ... Tim and Carol are and that they are doing.- Listening and choosing the correct answers.- Comparing their answers with the partner’s.* key: a- 1 b-2 c-2where Tim and Carol are and that they...

unit1: A visit from a pen pal

... đọc to bức th c a mình September 10thDear, I arrived at Hang Co Railway Station at 9a. m. My aunt took me home by taxi .Ive visited HCMs Mausoleum. I wasmoved to tears when I saw Uncle Ho. ... vởSecondly: come from ship at sea Thirdly : garbage isNext: waste materials come from factoriesfinally: Oil is washed from the land4. Post listening- GV tổ chức trò chơi Chaigames vớichủ đề ... GrammarIII. Teaching aids: Bảng phụIV. Procedure1. Warm up- GV nêu ? gợi mở Open questions Have you ever been to a park (a publicplace)?- Nghe, trả lờiAre there any garbage bins in the park?Are...

172
3,846
4

Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"

... (5) and insufficient (6). Y-axis: Percentage of patients Panel A: AVNRT. Panel B: AVRT. Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying ... of radiofrequency ablation versus medical therapy on the quality-of-life and exercise ca-pacity in patients with accessory pathway-mediated supraven-tricular tachycardia: a treatment comparison ... HJ. Acute results of transvenous cryoablation of supraventricular tachycardia (atrial fibrillation, atrial flutter, Wolff-Parkinson-White syn-drome, atrioventricular nodal reentry tachycardia)....

Xem thêm

Từ khóa: a view from the trading firms a view from the front lines what to expect a view from the field a view from inside the mayor s offi ce in lawrence kansas commercialization of plant derived natural products as pharmaceuticals a view from the trenches preparation of a high quality cdna library from a single cell quantity of mrna using chum rna a view from the usa infections and dementia the view from a developing nation a view from the british isles psychopathologic assessment can usefully inform therapy a view from the study of personality a view from the death registers of skye and kilmarnock a view from iran models a view from the whisker tip a view from oncology a view from the clinic Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ