Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... hnRNP A1 CUAGACUAGA 5428–5437ESE2 SC35, SRp40 CCAGUAGAUCCUAGACUAGA 5418–5437 A5 ESE GAR ASF ⁄ SF2, SRp40 GAAGAAGCGGAGACAGCGACGAAGA 5558–5582 [7] A7 ESS3 hnRNP A1 ,hnRNP E1 ⁄ E2AGAUCCAUUCGAUUAGunknown8047–8062 ... 32]ISS hnRNP A1 UAGUGAAUAGAGUUAGGCAGGGA 7928–7950ESE3 ASF ⁄ SF2 GAAGAAGAA 8016–8025hnRNP A1 UAGAAGAAGAA 8018–8025 HIV-1 alternative splicing regulation J. Tazi et al.872 FEBS Journal 277 (2010) ... Journal compilation ª 2010 FEBS. No claim to original French government worksMINIREVIEW Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action Jamal Tazi1,...
- 10
- 434
- 0
Báo cáo khoa học: Alternative splicing: role of pseudoexons in human disease and potential therapeutic strategies pot
... concentrations. N Engl JMed 331, 974–980.88 Faa`V, Incani F, Meloni A, Corda D, Masala M,Baffico AM, Seia M, Cao A & Rosatelli MC. (2009).Characterization of a disease-associated mutation affect-ing ... JP, Markham AF, Giardina PJ, Li A &Kazazian HH Jr. (1984) Beta-thalassemia in Chinese:use of in vivo RNA analysis and oligonucleotidehybridization in systematic characterization of molecu-lar ... (2006) An apparentpseudo-exon acts both as an alternative exon that leadsto nonsense-mediated decay and as a zero-length exon.Mol Cell Biol 26, 2237–2246.38 Buratti E, Baralle M & Baralle...
- 15
- 467
- 0
Báo cáo khoa học: Alternative splicing: good and bad effects of translationally silent substitutions pdf
... altered isoformproportions, activation of a control mechanism such as nonsense-mediated decay, as well as the creation orloss of splicing variants. As this process has a signifi-cant impact on ... codon information, for an amino acid.Translationally silent variations thataffect splicing and diseaseClinical studies identifying aberrant splicing mutationsare of great importance for genetic ... classified as pathogenicmutations or genetic variations causing predispositionto disease. The first category usually has a devastatingeffect on splicing, with a substantial loss of originalprotein...
- 5
- 437
- 0
Báo cáo khoa học: Alternative splicing produces an H-protein with better substrate properties for the P-protein of glycine decarboxylase doc
... (1988)Resolution and characterization of the glycine cleavagereaction in pea leaf mitochondria. Properties of theforward reaction catalysed by glycine decarboxylaseand serine hydroxymethyltransferase. ... Germany). For exactdetermination of the mean mass, the protein sample wasmixed with an aliquot of protein standard I (BrukerDaltonics) to allow internal calibration, resulting in a meanmass ... Flaveria trinervia, Arabidopsis thalianaor Synechocystis as substrate. H-proteins carrying an N-terminalextension of four amino acids, which remain after thrombin cleav-age of the His tag, are...
- 7
- 394
- 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx
... UGUUGUUUUAGUGAUCAGAAGGUGY-box family miRNABrd-box: 5´ AGCUUUA |||||||dme-miR-4 3´ AGUUACCAACAGAUCGAAAUAdme-miR-79 3´ UACGAACCAUUAGAUCGAAAUABrd-box family miRNAsK-box: 5´ cUGUGAUa ||||||dme-miR- 2a ... target mRNAs in a sequence-specific manner. A large number of genes appear to be the target of miRNAs, and an essential role for miRNAs in the regulation of various conserved cell signaling cascades,such ... AUGCUAAAUCCGCUUCAGUAUUU ||||||| hsa-miR-200b 3´ AGUAGUAAUGGUCCGUCAUAAUhsa-miR-200c 3´ AGGUAGUAAUGGGCC-GUCAUAAUTGF- s/BMPsR-smadspri-miR-21,19 9a pre-miR-21,19 9a DroshaDGCR8p68SignalMAPKKKERKmiR-21Spry1,...
- 9
- 684
- 0
Tài liệu Báo cáo khoa học: Small molecule regulation of Sir2 protein deacetylases ppt
... that an increase in Nmnat1 activity leads toFig. 2. (A) NAD+salvage pathway in yeast. (B) NAD+salvage pathway in mammals.Small molecule regulation of Sir2 protein deacetylases O. Grubisha ... product formation [38,39]. Nicotin-amide acts as a classical noncompetitive product inhi-bitor of the forward deacetylation reaction and wasshown in vivo to decrease gene silencing, increaserDNA ... avail-ability of NAD+ for ySir2 without detectable changesin steady-state NAD+levels. These data support theidea that the NAD+salvage pathway in yeast canregulate ySir2 activity by decreasing...
- 10
- 474
- 0
Tài liệu Báo cáo khoa học: Oxygen-dependent regulation of hypoxia-inducible factors by prolyl and asparaginyl hydroxylation pdf
... asparagine in the CADwassubstitutedwithanasparticacidresidue,FIH-1hydroxylase activity for the aspartic acid residue was only7% of that obtained with asparagine. This clear differencein amino ... otherasparaginyl hydroxylase enzymes, which can hydroxylateboth asparagine and aspartic acid residues, the FIH-1enzyme was shown to have a clear preference for asparaginein the CAD of HIF- 1a ... aspartic acid residues in theCAD (Asp799) and the CH1 domain that help to stabilizethe complex. Analysis of the asparagine and aspartic acidhydroxylation products in the EGF like domains of...
- 10
- 603
- 0
Báo cáo khoa học: Calmodulin-mediated regulation of the epidermal growth factor receptor doc
... orSTIM2, acting as a Ca2+sensor, located in the ERmembrane, are translocated to the plasma membraneand clustered at the ER-plasma membrane junctionsafter the detection of a shortage of Ca2+in ... inositol-1,4,5-trisphosphate; Jak2, Janus kinase 2; JM, juxtamembrane; LD, like domain; NCX, Na+⁄ Ca2+exchanger; NLS,nuclear localization sequence; PKC, protein kinase C; PMCA, plasma membrane Ca2+-ATPase; ... could form an antiparallel heli-cal dimer, and that the side chains of the basic aminoacids could interact with the negatively-charged innerleaflet of the plasma membrane [69].Kinetics measurements,...
- 16
- 459
- 0
Báo cáo khoa học: Alternative splicing: global insights potx
... Watahiki A, Nakamura M,Arakawa T et al. (2003) Cap analysis gene expression for high-throughput analysis of transcriptional startingpoint and identification of promoter usage. Proc NatlAcad ... [10] – as well as a global analysis of alternative splicing changes pro-duced as a result of splicing factor knockdown orknockout, provide additional ‘factor-centric’ datasetsthat can contribute ... investigation of alternative splicing at a global scale. Splice-sensitive microarray platformsand deep sequencing allow quantitative profiling of very large numbers of alternative splicing events, whereas...
- 11
- 544
- 0
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt
... CTGCTGTAATAATGGGTAGAAGGARA439 GGAATTCCATATGCGTATTATGGCCAGARA440 TATTTACTCGAGAATCCCCTCCTCAGCARA444 CGGGATCCACCGTGAAAAAGAAAGAATTGTCARA451 GAATTCATAAAGAAGCTTTGTCTGAAGCARA456 CGGCGCGTCATATGGCCAGTCATGATAARA457 ... CGGCGCGTCATATGGCCAGTCATGATAARA457 TGATACGCATATGTCACCGGCTGGCARA458 CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGAATGCCAGCCGGTGCCACARA459 GTGTCACCGGCTGGCATTCTGATTGACTTGGACAAGGATGTAACCAAATTGGCTGAGARA460 CGTGAATTCACCGAGCATGTCACCAAAGCCARA477 ... CGTGAATTCACCGAGCATGTCACCAAAGCCARA477 AATCAGAATGGGATCCGGTGAARA486 CGGCTGACATTCTGATTGACTTGGACGGARA487 CAATCAGAATGTCAGCCGGTGACACAGGARA509 CC AGT CAT GAT A AG CCT GTG TCA CCGARA510 CGG TGA CAC AGG CTT ATC ATG...
- 14
- 594
- 0
Từ khóa: chuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam