Estrogen in the adult male reproductive tract: A review ppt
Estrogen in the adult male reproductive tract: A review ppt
... ER localization in the male reproductive tract using ICC alone. Autoradiography andestradiol binding assays indicate that ER is present in the rat epididymis. RT-PCR data also show that ERα ... the adult male reproductive organs.At best, it was thought that an estrogen binding ability wasleft over from developmental processes and that estrogen played only a small role in the adult male ... very strong labeling of the efferent ductules and initial segment epididymis, withlesser binding in the distal tract. However, binding assaysTable 1: P450 Aromatase in the adult male reproductive...
- 14
- 370
- 0
Tài liệu The Contribution of Sexual and Reproductive Health Services to the Fight against HIV/AIDS: A Review pptx
... becamefeasible and affordable, there appears to beincreasing demand, especially in sub -SaharanAfrica.75It is usually provided in three mainways, often depending on the prevalence rates in the antenatal ... genital area, and a highe r inci-dence of cervical intraepithelial neoplasia (CIN)and advanced cervical disease, and at youngerages, than women in the general population, a risk which increases ... it has been the healthsector that has taken a lead in these efforts,including seeking ways of making antiretroviraltherapy accessible. In many countries, and withinmost of the international...
- 23
- 719
- 0
Tài liệu Báo cáo khoa học: Distribution of class I, III and IV alcohol dehydrogenase mRNAs in the adult rat, mouse and human brain ppt
... 6Human GAT CCG GGA AGC ACC AGC CAC TTT ACA GCC CAT GAT AAC TGC CAA TCC GhADH3-2 ADH class III,exon 9Human GGA TCT GTT CTT TAA TCA ACG GGG ACT GAG ACC CTT AAA AGT TCA ACG TTA TGhADH3-3 ADH class ... 6Human AGC CCA TGA TGA CTG ACA GGC CAA CTC CTC CCA GGC CAA AGA CGA CGC A hADH4-3 ADH class IV,3¢UTRHuman CAC CAA GTT ATG TAA TGA TGA TTC TTA ATC GTT GAA AAA TGT GCC CGT C1318 D. Galter et al. ... oxidation in brain tissue. Regardingretinoid metabolism in the adult brain, enzymes other thanADH4 must be active, because in vivo and in vitro dataindicate that adult brain tissue, in particularly...
- 11
- 603
- 0
Tài liệu RESULTS BASED MANAGEMENT IN THE DEVELOPMENT CO-OPERATION AGENCIES: A REVIEW OF EXPERIENCE docx
... performance measurement and analysis (PMA) database containing the operating units’program performance monitoring data (e.g., baselines, targets and actual results data for strategicobjectives and intermediate ... frameworks that clarify their agency-wide goals, indicators and targets, and are still in the processes of developing databases and collecting data (e.g., DFID, AusAID, UNDP). In these cases, plansfor ... Developing partnerships with others to integrate their varied performance information availableon their programs.− Increase technical assistance to state and local evaluators.− Developing catalogues...
- 158
- 572
- 0
Tài liệu Relationship between anthropometric variables and nutrient intake in apparently healthy male elderly individuals: A study from Pakistan docx
... fabdominal fat. Accordingly, a person with a BMI in the “ normal” weight range may exceed the safe range ofabdominal fat. In aged individuals with a decline in leanmuscle mass, their BMI may ... for the integrity of the data and the accuracy of the analysis. All authors read and approved the final manuscript.Competing interests The authors declare that they have no competing interests.Received: ... made in dupli-cate and the means of paired values were used in the analyses. The data were statistically analyzed using JMP(Version 7.0. SAS, USA). As the current study involvedfour BMI categories,...
- 9
- 525
- 0
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a GSP-FwdNM_200751 TGGGGAGGACTTTTATGCTGTRPE6 5a ... usingTrizol reagent (Invitrogen, Carlsbad, CA, USA) and furtherpurified by an RNeasy kit (Qiagen, Valencia, CA, USA). The cDNA was synthesized using the TaqMan reverse transcrip-tase system (Applied...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... H, Okamura K, Bauer PO, Furukawa Y, ShimizuH, Kurosawa M, Machida Y, Miyazaki H, Mitsui K,Kuroiwa Y et al. (2008) RNA-binding protein TLS is a major nuclear aggregate-interacting protein in hunting-tin ... substantianigra pars compacta and appearance of Lewy bodiesconsisting of aggregated protein, mainly a- synuclein, in Keywordsamyloid; fibrillation; Parkinson’s disease;synuclein; thioflavin TCorrespondenceI. ... determined by the bicinchoninicacid assay [38] using bovine serum albumin as a standardprotein. The pooled eluate fractions were dialysed againstwater and then lyophilized.Gel electrophoresis and...
- 11
- 754
- 0
Tài liệu EFFECTS OF AIR POLLUTION FROM A NICKEL-COPPER INDUSTRIAL COMPLEX ON BOREAL FOREST VEGETATION IN THE JOINT RUSSIAN-NORWEGIAN-FINNISH BORDER AREA ppt
... areas to the southeast of Nikel, in the central part of the area (Petsamo formation), and in the uppermost part of the Pasvik Valley (Reimann et al. 1998). The Barents Sea creates a climatic ... estimated as an average of the assessments within the 1 m ¥ 1 m quadrates and used as environmental vari-ables to explain the variation in ground vegeta-tion. Extrapolated climatic data from ... Scots pine and birch forests, and encompasses the smelter in Nikel, the roasting plant in Zapolyarnyy and the surrounding affected area, as well as less affected areas to the west and south...
- 18
- 640
- 0
Tài liệu Báo cáo khoa học: A second novel dye-linked L-proline dehydrogenase complex is present in the hyperthermophilic archaeon Pyrococcus horikoshii OT-3 pptx
... ribonuclease A (13.7 kDa) serving as molecular standards (Amersham Bio-science).Analysis of the N-terminal amino-acid sequences The N-terminal amino-acid sequences of the enzymes wereanalyzed using ... strain was obtained from the JapanCollection of Microorganisms, (Saitama, Japan), and thengrown at 90 °C for 18 h under anaerobic conditions. The microorganism was cultured in medium containing ... ammonium sulfate in buffer A. The squares and circles show the activity and A 280, respectively.FAD, FMN and ATP-containing amino-acid dehydrogenase R. Kawakami et al.4046 FEBS Journal 272 (2005)...
- 11
- 549
- 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf
... role and importance of the aspartate in the catalytic triad is not fully understood because several serineproteases do not have an aspartate as the catalytic apparatus.However, for chymotrypsin-type ... mutantsW169F–H21 0A and W16 9A H21 0A were constructed.Peptidase activity was determined using VLK-MCA as the substrate and the increase in fluorescence of the releasedMCA was monitored. The maximum peptidase activity ... typically W169V andW16 9A, deviates from the original position. In the struc-tural deviation, the solvent ASA of the side-chain of His210increased with the decrease in size of the side-chain atresidue...
- 7
- 603
- 0
Từ khóa: general structure function and regulation of the male reproductive tractwriting in the margins six strategies at a glancein the balance of payments statement a current account surplus will be matched by a trade surplusexperience with literacy in the primary language influence learning a second languagehow does experience with literacy in the primary language influence learning a second languagethe role of motivation in the learning of english as a foreign language• explain the purpose and utilization of a review of literature in a nursing research proposalevaluates the purpose and utilization of a review of literature in a nursing research proposalexplain the purpose and utilization of a review of literature in a nursing research proposalwhere the company is the trustee venturer for the loss to be attributed to non trustee venturers when the balance in the profit sharing agreement becomes a debtor balance with a credit to account 7510where the company is the trustee venturer for the gains to be attributed to non trustee venturers while the balance in the profit sharing agreement remains a debtor balance with a debit to account 6510accounting for non current assets derecognition of intangible assets and change in the basis of measurement of a class of assetserectile dysfunction in the aging maleinfertility in the aging malegrowth hormone and body composition in the aging maleBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ