The impact of a cancer Survivorship Care Plan on gynecological cancer patient and health car provider reported outcomes (ROGY Care): study protocol for a pragmatic cluster randomized controlled trial potx
The impact of a cancer Survivorship Care Plan on gynecological cancer patient and health car provider reported outcomes (ROGY Care): study protocol for a pragmatic cluster randomized controlled trial potx
... Open Access The impact of a cancer Survivorship Care Plan on gynecological cancer patient and health care provider reported outcomes (ROGY Care) : study protocol for a pragmatic cluster randomized ... participants on the otherhandareunawareofthegroupassignment,astheyareunder the assumption that the hospital is providingusual care. Intervention versus usual care Usual care: The health care provider ... health care providers’ evaluation of SCP care. Discussion: The ROGY Care trial will help to gain insight into the impact of SCP care on patient reported outcomes, and on the evaluation of cancer survivors...
- 8
- 786
- 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... of the initiation of NARP in 2003. The study in-cluded the data obtained from all of the four univer-sity hospitals, and one referral tertiary -care educa-tional state hospital in Ankara. These ... ra-tionale after the initiation of NARP. Also carbapenem resistance rates of Pseudomonas spp and Acinetobacter spp decreased correlating with decreased consump-tion of carbapenems after NARP ... Pseudomonas spp., 4801 S.aureus. Data on bacterial resistance are summarized in table 1. Changes in the consumption of given antimicro-bials for two years before and after the initiation of NARP...
- 6
- 692
- 0
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... measure. In addition, conventional methods have the advantage of being investment evaluation settings. Their major drawback of evaluation is that they focus on the estimation of cash flows and ... customer and employee retention and quality measures and financial indicators such as profitability (Banker and Mashruwala, 2000, Banker, Potter and Srinivasan, 2001; Ittner and Larcker 199 8a and ... involvement of the employees, and tracking and control of the performance. Success is a multidimensional concept and it can vary throughout the time and depending on the analysed company, and the sector...
- 15
- 796
- 0
The Impact of a Corporate Culture of Sustainability on Corporate Behavior and Performance pptx
... that has any degree of statistical significance is when the company bases its performance measurement on relevant external standards and programs, such as AccountAbility’s AA 1000 standard and ... audit and assurance procedures are so uncommon. These are based on the fact that technologies for measuring and auditing nonfinancial information are still in their infancy and 24 remain at a ... Integration of environmental and social information in financial reports is increasingly being advocated as a way to ensure that corporations are held accountable for their impact on the environment...
- 57
- 447
- 0
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx
... A 1expðÀkHX;1Þtþ A 2expðÀkHX;2Þtþ A 3where A 1, A 2, and A 3are the fractions of the fast, slow and stable amide protons and kHX,1 and kHX,2are the apparentexchange rate constants for the fast and ... 5. Statistical correlation analysis (ANOVA) between the theoret-ical (*) and experimental global conformational (A) dynamics and (B)energetics parameters determined for the Lac -a- CT conjugates. ... (DGHX,1) and the Gibbs free-energy of activation for reactions (A) acylation (DG„k2) and (B)deacylation steps (DG„k3) for the Lac -a- CT (s) and Dex -a- CT (n)conjugates.Table 5. Thermodynamic...
- 17
- 531
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... GLU H44 7A forward (5¢- GCAAGTCATTTTGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAATGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTTAACAGATATGCCGGTTATT CCACCGGT ... as a template. The following oligonucleotides were used: GLUR1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAACTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢-GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTTTGAAT-3¢); ... withinversion of configuration at the anomeric carbonwhich requires a pair of carboxylic acids at the active A BFig. 2. Glu with two acarbose molecules and a phosphate anion. The anion is hiddenbelow...
- 11
- 548
- 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CGCGGATCCAATCTTGATGGGGCAGCCGGAGAGGPLA5G1 (F) AGGAYTCTCTGGATAGTGGPLA3G1 (R) CTCACCACAGACGATWTCCPLA5G2 (F) CGGTAAGCCCATAACGCCCAPLA3G2 (R) CAGGCCAGGATTTGCAGCCPLA3G4 (R) CATAAACAYGAGCCAGTTGCCARTF a (F) GAGTGGATGCACAGTCGTTGARTR a (R) ... GAGTGGATGCACAGTCGTTGARTR a (R) GAAACGGAGGTAGTGACACATAtxBFb(F) GCCTGCTCGAATTCGGGATGAtxBrcb(R) CTCCTTCTTGCACAAAAAGTGAtxACFc(F) CTGCTCGAATTCGGGATGAtxACrcc(R) GTCYGGGTAATTCCTATATAAmlFd(F) GTGATCGAATTTGGGAAGATGATCCAAmlrcd(R) ... that of the V. am. ammodytes ammodytin I1 gene.All PLA2 genes contained a TAA stop codon, anAATAAA polyadenylation site 80 bp downstream from the stop codon, and a TATA-like box (CATAAAA) 270...
- 10
- 451
- 0
The impact of technology on team functioning within a given organization
... mutuallyaccountable.”14(Mandatory Unit 3: Organizations and Behaviors, 2004, p251-252) A virtual team is an evolutionary form of a network organization enabled byadvances in information and ... responsibility, team spirit,administration and increase facility.Actually, if the team has been chosen carefully, you can take advantages of workforce-diversity, for example as a good range of abilities, ... Contingency approach is also used in team management of Texas Instrument.Basically, rely on characteristic of this approach, there is no one best way to manage and the management style appropriate both...
- 9
- 3,188
- 2
Tài liệu Activity 7.2: Determining the Impact of Technology on a Windows DNA Design docx
... Objectives After completing this activity, you will be able to: ! Specify and articulate the impact of technology types upon each layer of a Windows DNA solution. Before You Begin This activity ... write the class consensus on a flip chart. Use the space below for brainstorming. Activity 7.2: Determining the Impact of Technology on a Windows DNA Design 51 Write your answers in the ... includes both small group tasks and class discussion. Prerequisites There are no prerequisites for this activity. Materials To complete this activity, you may refer to the Ferguson and Bardell, Inc....
- 4
- 631
- 0
Từ khóa: characterization of film stability blood compatibility and the impact of a membranemimetic film on barrier permeabilitythe stages of a butterfly s life cycle are egg larva pupa and adultdetermining the impact of technology on a windows dna designthe impact of salt reduction in bread a reviewthe structure of a software test planpsychosocial factors and the development of breast cancer a metaanalysiswhat is the impact of inflation deflation and unemployment on a societya day in the life of a child care workerthe structure of a test planwhat is the structure of a software test planmeasuring the impact of ecological disintegrity on human health a role for epidemiologythe impact of eu law on health care professional practicechecking the validity of a plan guideunderstand the elements of a strategic planguidance for the management of breast cancer treatment induced bone loss a consensus position statement from a uk expert group 2008Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ