Tài liệu Báo cáo Y học: Dissecting the effect of triﬂuoroethanol on ribonuclease A Subtle structural changes detected by nonspeciﬁc proteases ppt

... differences in the changes of the tertiary and secondary structures are reflected in the activity of RNase A, its activity towards cCMP was measured as a function of the concentration of trifluoroethanol ... All other chemicals were the purest ones commercially available.Determination of RNase A concentration The protein concentration of RNase A stock solutionwas determined by using the molar absorption ... 1. Activity of proteinase K as a function of the concentration of trifluoroethanol. Activity of proteinase K was determined withN-succinyl-Ala-Ala-Ala-p-nitroanilide as substrate at 25 °Casdescribed...

Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf

... primer5¢-d(TAATGCATCCGCTTTAATTTCTGAAATTAATG)-3¢, lower primer 5¢-d(TCAGAAATTAAAGCGGATGCATTATTTGCATG)-3¢. The upstream primer containing the NdeI restriction site(underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAAAAAATTG)-3¢ ... Gly261 and Gly262. The replacement of Gly262 by Ala resulted in an inactive enzyme. Substitution of Gly261 by Ala resulted to an enzyme with lower stability andincreased energy of activation. ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1). The mutantG26 1A /Y2 6 9A exhibits an E a almost the same as in the caseofthenativeenzyme(Table1).Thermal inactivation...

Tài liệu Báo cáo Y học: NMR-based determination of the binding epitope and conformational analysis of MUC-1 glycopeptides and peptides bound to the breast cancer-selective monoclonal antibody SM3 pptx

... basically followed t he same schemepresented above for the peptide. As the programDYANAcannot handle glycopeptides it was substituted by the DGalgorithm of the SYBYLsoftware package. Again, ... does not alloweasy analysis of the contribution of the carbohydrateportion. To assess the involvement of carbohydrates inantibody recognition of glycosylated structures numerousglycopeptides ... caused by the GalNAc residue and/or by the binding contribution fromtheGalNAcresidue.Docking the glycopeptide to the antibody the sugar ringhas little contact to the protein surface. Only the...

Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx

... the presence of GTP, UTP and the nonhydrolyzable ATPanalog ADPNP [8]. Furthermore, it was shown that the fold activation of the glutaminase activity by GTP wassimilar to that of the overall CTP synthesis ... injectionj)1andj,[S]syris the concentration of the injectant in the syringe.Analysis of initial velocity dataAnalysis of saturation curves was performed by nonlinearregression usingv ¼kcat½E½SKMþ½Sð4Þwhere ... the assay was 1 mM.Isothermal titration calorimetry (ITC) assay of glutaminase activity and CTP synthesisCTP synthase at concentrations between 0.029 and 1.16 lMwas loaded in the reaction...

Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

... strand 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢Asp125Asn Sense strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢Glu127Ala Sense ... strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢Anti-sense strand 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢Asp125Ala/Glu127Ala Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢Anti-sense ... 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢Anti-sense strand 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-3¢Tyr183Phe Sense strand 5¢-TATGTATGGGTTCAATTCTTTAACAATCCACCATGCCAG-3¢Anti-sense strand 5¢-CTGGCATGGTGGATTGTTAAAGAATTGAACCCATACATA-3¢Asp125Ala/Tyr183Phe...

Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx

... were furtherharvested for analysis.Purification and quantification of endocannabinoids The extraction, purification and quantification of ananda-mide, 2-AG and PalEtn from immature and maturedendritic ... (B) was loaded onto the agarose gel. In (B), data are not representative of all the samplesanalyzed, as in only three preparations out of the six analyzed was a decrease of mRNA transcripts ... anandamideand 2-arachidonoylglycerol (2-AG), the cannabinoid CB1and CB2receptors, and one of the enzymes mostlyresponsible for endocannabinoid hydrolysis, the fatty acidamide hydrolase (FAAH)....

Tài liệu Báo cáo khoa học: Seeking the determinants of the elusive functions of Sco proteins pptx

... terminalcomponent of the respiratory chain, located in the inner mitochondrial membrane of eukaryotes and in the plasma membrane of many prokaryotes. The catalytic core of the enzyme is composed of the ... Aoyama H, Yamashita E, Tomizaki T,Yamaguchi H, Shinzawa-Itoh K, Nakashima R, YaonoR & Yoshikawa S (1995) Structures of metal sites of oxidized bovine heart cytochrome c oxidase at 2.8 A ˚.Science ... disulﬁde-reductant. The onlyother available crystal structure of a metal-loaded Sco1form (yeast Sco1) [31] also shows a quite unexpectedmetal coordination. The crystal has been obtained by soaking apo-Sco1...

Tài liệu Báo cáo khoa học: An autoinhibitory effect of the homothorax domain of Meis2 ppt

... Thus the nuclear ⁄ cytoplasmic localization of Prep1, and possibly of other Meis paralogs, may play a role in regulating transcriptional activity, but itappears that the Hth domain does not maintain ... activation by Meis2e (Fig. 1A) . How-ever, this activation by Meis2d was relatively weak, par-ticularly in light of the recent identiﬁcation of a strongAD in the C-terminal region of the related ... maintain the cytoplasmic localization of Prep1. Additionally, the greatest derepression that we observed was in the con-text of the GBD fusion proteins, which contain annuclear localization signal...

Tài liệu Báo cáo khoa học: Glucuronate, the precursor of vitamin C, is directly formed from UDP-glucuronate in liver pptx

... UDP-glucuronate and UDPGlcNAc, and the assay was initiated by addition of these two nucleotides.Where indicated, the assay was initiated by the addition of the enzyme preparation to an otherwise ... ATP-Mg was antagonized by metyra-pone, aminopyrine and chloretone (Fig. 7B,C). Furthercharacterization of the cofactor indicated that it wasretained on charcoal (Fig. 7A) and on the anion-exchan-ger ... glu-curonate assay. Glucuronate was assayed enzymaticallywith E. coli uronate isomerase and mannonate dehydroge-nase [38]. This method was also used to assay glucuro-nate 1-phosphate and b-glucuronides,...

Tài liệu Báo cáo khoa học: Co-operative effect of the isoforms of type III antifreeze protein expressed in Notched-ﬁn eelpout, Zoarces elongatus Kner ppt

... isoforms of nfeAFP and ana-lyzed the thermal hysteresis (TH) activity of each as a function of pro-tein concentration. We also examined the change in activity on mixing the isoforms. TH was ... mm of nfeAFP8.These data indicate that ‘less active’ AFP isoforms canexert a substantial level of antifreeze activity after the addition of a small amount of ‘active’ isoform. The less active ... clearconcentration dependence on, the addition of a smallamount of a QAE1 isoform, nfeAFP8 (Fig. 7). This issimilar to the case of the QAE2 isoform, nfeAFP13; the activity of its monomer was...

Xem thêm