Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
... Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL Elena S. Bochkareva, Alexander S. Girshovich and Eitan BibiDepartment of ... that maintenance of the correctfolding state of GatY in E. coli probably requires the assistance of two chaperone systems. The identification of UP12 as a putative in vivo substrate of GroEL wasinteresting, ... familyare proteins of 142–144 amino-acids long; they are acidic and presumably located in the cytoplasm like UspA.Members of this family share a strikingly similar hydro-pathy profile (data not...
- 9
- 548
- 0
Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf
... Protein kinases and phosphatases that acton histidine, lysine, or arginine residues in eukaryotic proteins: a possible regulator of the mitogen-activated protein kinase cascade.Pharmacol. Ther. ... A ˚keEngstro¨m at the Peptide Synthesis and Analysis Laboratory of the Department of Medical Biochemistry and Microbio-logy, Uppsala University. The SP6 primer 5¢-ATT TAGGTG ACA CTA TAG-3¢ and the three ... phosphohistidine phosphatase and anendosomal protein may be of interest in the light of the recently described histidine phosphorylation of annexin Ifrom a membrane preparation of ovine tracheal epithelia[34]....
- 8
- 666
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... STAT protein all-alpha domain, STAT protein DNA-binding domain and SH2 domain of stat6, and the zinc-finger domain, leucine-zipperdomain and fork-head domain of foxp3. In addition,for stat6 and ... interactionsbetween STAT dimers on adjacent DNA-binding sites, a coiled-coil STAT protein all-alpha domain, which isimplicated in other protein protein interactions, a STAT protein DNA-binding domain and an SH2domain, ... CTGGATTGAAGCGCCCTCGGTTAATC 3¢-RACEZf5¢tbet-R1 GCTGCCTTTGTTATTTGTAAGCTTCAG 5¢-RACEZf5¢tbet-R2 GGAAACTTCCTGTCTCATCCAGTG 5¢-RACEZffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCRZffoxp3-R1 CTTCAACACGCACAAAGCAC Initial...
- 20
- 689
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni pdf
... nm and 680 nm filters.SmSmad1B protein interactionsYeast two-hybrid and three-hybrid assays The yeast strain Y1 90, a HIS3 ⁄ LacZ reporter strain, wasutilized in the yeast two-hybrid assays. ... of the TGF b–activin pathway include Smad2 and Smad3. The R-Smads of the BMP pathwayinclude Smads 1, 5 and 8. The type I receptor phos-phorylates the R-Smad at its C-terminal MH2 domain,causing ... light gray, gray and dark gray, respectively, and the regions representing the 5¢- and 3¢-UTRs areshown in white in the genomic gene and the cDNA. Intron size in bp, domain size in bp and domain...
- 19
- 653
- 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... suggest that certain enzymes, and therefore the corresponding genes of the A2 0 1A biosyn-thetic pathway, may be related to their counterparts of the puromycin and hygromycin A biosynthetic pathways,respectively. The ... Further identification and quantification of puromycin were achieved by a Pac enzymatic assay[21].Preparation of 3¢-amino-3¢-deoxyadenosine3¢-amino-3¢-deoxyadenosine was obtained from Helmin-thosporium ... complementa-tion assays. The ataP5, ataP4 and ataP10 genes were alsoindependently inserted in the pIJ702 vector and the resultingplasmids pA 2A5 , pA 2A4 and pA 2A1 0, respectively(Materials and methods),...
- 9
- 728
- 0
Tài liệu Báo cáo Y học: Identification of syntaxin-1A sites of phosphorylation by casein kinase I and casein kinase II ppt
... Identification of syntaxin- 1A sites of phosphorylationby casein kinase I and casein kinase IIThierry Dubois1, Preeti Kerai2,*, Michele Learmonth1, Andy Cronshaw1 and Alastair Aitken11 The ... (reviewed in [17,18]). Syntaxin- 1A is associated with the presynapticmembrane and associates with the plasma membrane protein SNAP-25 and the synaptic vesicle protein syna-ptobrevin to form a ÔSNARE ... CKI) are s erine/threonine protein k inaseswidely expressed in a range of eukaryotes including yeast,mammals and plants. They have been shown to play a role in diverse physiological events including...
- 6
- 403
- 0
Tài liệu Báo cáo khoa học: Identi®cation and properties of type I-signal peptidases of Bacillus amyloliquefaciens doc
... Cloning of sipUHV11 TTRTCNCCCATNACRAARTA Cloning of sipUU1 TTGAAYGCNAARACNATHACNYTNAARAA Cloning of sipUV1 TTGAARAARMGNTTYTGGTTYYTNGC Cloning of sipVV2 GTNTTYATNGTYTAYAARGTNGARGG Cloning of sipVV3 ... TCNGCNGCNGCRTTRTTRTCNCCYTTNGT Cloning of sipWW7 TTGTGTAAAAGTGATGACATCGCC Cloning of sipWW8 GTGATCCCGATTATTCTGTGTGTT Cloning of sipWW9 GGCGATGTCATCACTTTTACACAA Cloning of sipWW10 AACACACAGAATAATCGGGATCAC Cloning ... TCNGCRTCNSWNATNACNCCNACNAT Cloning of sipVV4 GCCAAAACAACGATAAGCACGCC Cloning of sipVV5 GGATTCATGCTGATTCCTTCGAC Cloning of sipVV6 ACTTGGCACTACACCGCACCTCATGCG Cloning of sipVV7 ATTTCGTGATTGGCGACAACCGC...
- 12
- 595
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon doc
... N-acetylornithinetransaminase; GAT, glutamate N-acetyltransferase; AOD, N-acetyl-ornithine deacetylase; OCT, ornithine carbamoyltransferase; ASS,argininosuccinate synthase and ASL, argininosuccinate lyase.Wild ... The pathway of citrulline and arginine biosynthesis. AGS,N-acetylglutamate synthase; AGK, N-acetylglutamate kinase; AGPR,N-acetylglutamate 5-phosphate reductase; AOAT, N-acetylornithinetransaminase; ... which catalysesdeacetylation of N-acetylornithine yielding ornithine and acetate [11]. This linear pathway is regulatedby arginine-induced feedback-inhibition of N-acetyl-glutamate synthase, the...
- 12
- 649
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... 2000-fold increase in specificactivity. Analysis of the lectin on SDS/PAGE gave a singleband at apparent molecular mass of 34 kDa. The binding affinity of the lectin in the hemolymph of the freshwater ... hemagglu-tination assay.Preparation of asialo-erythrocytes. The procedure fol-lowed for preparing asialo-erythrocytes was that of Mercy and Ravindranath [24].Sialidase treatment of sialoglycoprotein. ... Bovine submaxillary mucin,which contains mainly 9-O-acetyl- and 8,9 di-O-acety-N-acetyl neuraminic acid was the most potent inhibitor of the lectin. Sialidase treatment and de-O-acetylation of...
- 8
- 616
- 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf
... N-terminal Ôtwin-arginineÕ signal sequence that ischaracteristic of cofactor-containing proteins translocatedinto the periplasm via the Tat translocase [27]. As deducedfrom the N-terminal sequence ... oCO2[11]. Acetate is oxidized to CO2by a modified acetyl-CoA pathway using typical methanogenic coenzymes[12,13]. Some of the reducing equivalents generated in the oxidative branch of the pathway are ... overlap (AF500 and AF501 overlap by 3 bp). The region 81–65 bp upstream of t he start c odon of AF499 was identified asan archaeal promoter element by seque nce analysis. The sequ ence AAAGGTTAATATA...
- 10
- 564
- 0
Từ khóa: tài liệu báo cáo nghiên cứu khoa họcbáo cáo y họctài liệu báo cáotài liệu báo cáo môn triếttài liệu báo cáo tài chínhtài liệu di truyền y họcchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP