Tài liệu Báo cáo khoa học: "Discovering Global Patterns in Linguistic Networks through Spectral Analysis: A Case Study of the Consonant Inventories" pdf

... though3Binning is the process of dividing the entire range of a variable into smaller intervals and counting the number of observations within each bin or interval. In ﬁxed binning, all the intervals ... ob-serve that markedness plays a very important role in shaping the global structure of the consonant in- ventories. In fact, if we arrange the consonants in a non-increasing order of the ﬁrst ... is increasingly popular these days to analyze the spectral properties of the graph’s Laplacian matrix. However, for rea-sons explained later, here we will be conduct spectral analysis of the adjacency...

Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

... Toyobo (Osaka, Japan), and New EnglandBiolabs (Beverly, MA, USA). All other reagents were of analytical grade from Nacalai Tesque (Kyoto, Japan) andWako Pure Chemical Industries (Osaka, Japan).Culture ... myokinase, enolase, lactate dehydrogenase, andglutamate dehydrogenase from Oriental Yeast, Osaka,Japan.Other analytical methods The N-terminal amino-acid sequence of the enzyme wasdetermined ... use ammonia as a substrate and was distinctfrom alanine dehydrogenase [18] and N-methylalaninedehydrogenase found by Lin & Wagner [17]. Lysineand ornithine were inert as an amine substrate;...

Tài liệu Báo cáo khoa học: An ecdysteroid-inducible insulin-like growth factor-like peptide regulates adult development of the silkmoth Bombyx mori docx

... holo-metabolous insects, the basal external structure of adult appendages such as wings, legs and antennaehave already been built at the time of pupation,although they are still very immature. The imaginaldisks ... for wing imaginal disks in Lepidoptera.Proc Natl Acad Sci USA 99, 15446–15450.30 Satake S, Masumura M, Ishizaki H, Nagata K,Kataoka H, Suzuki A & Mizoguchi A (1997)Bombyxin, an insulin-related ... H, Nagasawa H, Kataoka H,Isogai A, Tamura S, Suzuki A, Fujino M & Kitada C(1987) A monoclonal antibody against a synthetic frag-ment of bombyxin (4K-prothoracicotropic hormone)from the...

Tài liệu Báo cáo khoa học: "Humor as Circuits in Semantic Networks" doc

... generation.While humor/sarcasm recognition merits direct ap-plication to the areas such as information retrieval(Friedland and Allan, 2008), sentiment classiﬁca-tion (Mihalcea and Strapparava, ... the verbal theory of humor is an accessi-ble avenue for verifying the psycholinguistic theory. In this paper we take the Semantic Script Theory of Humor (SSTH) (Attardo and Raskin, 1991) - a widely ... overlap and incongruity. In the setup phase of the joke, instances of the two scripts are presented in a way that does not give away the less obviousscript (due to their overlap). In the punchline...

Tài liệu Báo cáo khoa học: "Mining metalinguistic activity in corpora to create lexical resources using Information Extraction techniques: the MOP system" doc

... information available to an average, idealized speaker). A Metalinguistic Information Database (MID), on the other hand, compiles the real-time data provided by metalan-guage analysis of leading-edge ... growth of their knowledge, is both feasible and practical. A good example of this NLP-based processing need is the MedLine abstract database maintained by the National Library of Medicine1 ... process of precisely situating a term or concept against the meaning network of interrelated lexi-cal items. The Metalinguistic Information Databa-ses in their present form are not, in full...

Tài liệu Báo cáo khoa học: "Discovering asymmetric entailment relations between verbs using selectional preferences" doc

... example, in the case of the verbs play and win, the related set of textual en-tailment expressions derived from the patterns arePnom(win, play) = {“player wins”, “playerswin”, “player won”, “players ... selectional preference.1Agentive nominalization has been obtained adding “-er”to the verb root taking into account possible special casessuch as verbs ending in “-y”. A form is retained as a correctnominalization ... The action vhwill be the one entailed by the verb vtheading the sentence. As an example in the sentence the player wins”, the action play850evocated by the agentive noun player is entailedby...

Tài liệu Báo cáo khoa học: "Discovering Corpus-Specific Word Senses" pot

... there are many edgeswithin an area of meaning, there is only a smallnumber of (weak) links between different areas of meaning. To detect the different areas of mean-ing in our local graphs, ... clustering (van Dongen, 2000). The quality of the Markov clustering depends stronglyon several parameters such as a granularity factorand the size of the local graph. In section 4, weoutline a ... k as well as the size of the local graph whichserves as input to MCL.An appropriate choice of the inflation param-80eter r can depend on the ambiguous word w tobe clustered. In case of...

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a GSP-FwdNM_200751 ... iron-dependent.Characterization of the kinetic parameters of the enzymatic activity of zebraﬁsh RPE65cTo determine the steady-state kinetics of the enzymaticactivity of zebraﬁsh RPE65c, the assay conditions...

Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

... models of data miningbut rather to a mathematical or ’virtual’ representation of the living system of interest in the computer, whereAbbreviationsFBA, ﬂux balance analysis; ODE, ordinary differential ... Software Access Experiment ReferencesMetabolism1 Amino acid,argininecatabolismto NO andpolyaminesNG, aortaendothelialcellsLow afﬁnity transporter and arginaseshare the control of the ... (or, in the case of accessibility, not available). Only computational meth-ods for the actual modeling and experimental methods that are used as basis or for the validation of the computational...

Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

... T-cell kinase (ITK) could in uence the infectivity of HIVand also have anti -in ammatory activity. Since 2006, several patients carry-ing a fusion protein, originating from a translocation joining ... directly involved in ligandbinding, presumably abolishing the interaction withsignaling partners. The remaining mutations alteramino acids located outside the ligand-binding pocketand reduce ... 287–299.27 Plebani A, Soresina A, Rondelli R, Amato GM, AzzariC, Cardinale F, Cazzola G, Consolini R, De Mattia D,Dell’Erba G et al. (2002) Clinical, immunological, andmolecular analysis in a large...

Xem thêm