Tài liệu Báo cáo khoa học: "Generating and Visualizing a Soccer Knowledge Base" potx

Tài liệu Báo cáo khoa học: "Generating and Visualizing a Soccer Knowledge Base" potx

Tài liệu Báo cáo khoa học: "Generating and Visualizing a Soccer Knowledge Base" potx

... Generating and Visualizing a Soccer Knowledge Base Paul Buitelaar, Thomas Eigner, Greg Gul- rajani, Alexander Schutz, Melanie Siegel, Nicolas Weber Language Technology Lab, DFKI GmbH Saarbrücken, ... and data already present in the corpus, the URLs of all available data from the website are matched against the IDs of the already extracted data. 2.2 Linguistic Annotation and Info...
Ngày tải lên : 22/02/2014, 02:20
  • 4
  • 363
  • 0
Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

Tài liệu Báo cáo khoa học: Applications and trends in systems biology in biochemistry docx

... (ischemia) of key metabolite concentrations and metabolic fluxes, both measured and nonmeasured. A general parameter sensitivity analysis is carried out to determine and characterize the parameters having ... then glycerol, and finally acetate Logic sim NG NG Single time points of fluxes and mRNA measured by microarrays Asenjo AJ, Ramirez P, Rapaport I, Aracena J, Goles E & Andre...
Ngày tải lên : 14/02/2014, 14:20
  • 91
  • 733
  • 0
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

... might acetylate active genes in association with the elongating Pol II. In addition to yeast SAGA and NuA4, the mammalian HAT HBO1 is also potentially able to be recruited to and to acetylate H4 ... [85]. Mast cells express GATA-2 as well as NFAT and AP-1, and GATA-2 initiates the formation of an additional discrete GATA-2 ⁄ AP-1 enhanceo- some-like complex existing upstream of the tw...
Ngày tải lên : 14/02/2014, 18:20
  • 29
  • 743
  • 0
Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

Tài liệu Báo cáo khoa học: miRNAs and regulation of cell signaling pptx

... miRNA Brd-box: 5´ AGCUUUA ||||||| dme-miR-4 3´ AGUUACCAACAGAUCGAAAUA dme-miR-79 3´ UACGAACCAUUAGAUCGAAAUA Brd-box family miRNAs K-box: 5´ cUGUGAUa |||||| dme-miR- 2a 3´ CGAGUAGUUUCGACCGACACUAU dme-miR-2b ... UTR 5´ AUUGUUUUAUCUUAUCAGUAUUA ||| ||||||| hsa-miR-200b 3´ AGUAGUAAUGGUCC-GUCAUAAU hsa-miR-200c 3´ AGGUAGUAAUGGGCC-GUCAUAAU site 2: ZEB1 3´ UTR 5´ AUGCUAAAUCCGCUUCAGUAUUU |||||||...
Ngày tải lên : 14/02/2014, 19:20
  • 9
  • 684
  • 0
Tài liệu Báo cáo khoa học: MicroRNAs and epigenetics doc

Tài liệu Báo cáo khoa học: MicroRNAs and epigenetics doc

... Hoffman AE, Zheng T, Yi C, Leaderer D, Weidhaas J, Slack F, Zhang Y, Paranjape T & Zhu Y (2009) micr- oRNA miR-19 6a- 2 and breast cancer: a genetic and epi- genetic association study and functional ... matlab, version 201 1a (Mathworks, Natick, MA, USA), we compared localization and strand direction between miRNAs and transcripts (Refseq genes and mRNAs). Intragenic and...
Ngày tải lên : 14/02/2014, 19:20
  • 12
  • 636
  • 0
Tài liệu Báo cáo khoa học: MicroRNAs and cardiovascular diseases ppt

Tài liệu Báo cáo khoa học: MicroRNAs and cardiovascular diseases ppt

... reticulum junction, and are activated by membrane depolariza- tion. I caL is important in heart function because it modulates action potential shape and contributes to pacemaker activities in the sinoatrial and ... 1944–1949. 66 D’Alessandra Y, Devanna P, Limana F, Straino S, Di Carlo A, Brambilla PG, Rubino M, Carena MC, Spazzafumo L, De Simone M et al. (2010) Circulating microRNAs ar...
Ngày tải lên : 14/02/2014, 19:20
  • 15
  • 684
  • 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... Functional and structural analyses of N-acylsulfonamide- linked dinucleoside inhibitors of RNase A Nethaji Thiyagarajan 1 , Bryan D. Smith 2, *, Ronald T. Raines 2,3 and K. Ravi Acharya 1 1 Department ... nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are available in the Protein Data Bank under accession numbers 2xog and 2xoi Abbreviations PDB...
Ngày tải lên : 14/02/2014, 22:20
  • 9
  • 626
  • 0
Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

... GCATCAACTTTCAAAAGAT F127E CGAGATAAGGGGACCAG TTAAATCCATGTGCACAG R144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATAC I152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCAT N154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGT K31 1A ... AAGAAAGTAACTGACGACATGGACATGTG CACATGTCCATGTCGTCAGTTACTTTCTT Y55G AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACT T56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG...
Ngày tải lên : 15/02/2014, 01:20
  • 10
  • 563
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... Canyuk B, Focia PJ & Eakin AE (2001) The role for an invariant aspartic acid in hypoxanthine phospho- ribosyltransferases is examined using saturation muta- genesis, functional analysis, and ... filter paper assay and tritium-labeled substrates. Experiments have been repeated three to four times and the data are given as the mean ± SD. k cat was calculated using M w (HPRT) = 27132 Da...
Ngày tải lên : 15/02/2014, 01:20
  • 11
  • 770
  • 0
Tài liệu Báo cáo khoa học: Enzymatic and electron paramagnetic resonance studies of anabolic pyruvate synthesis by pyruvate: ferredoxin oxidoreductase from Hydrogenobacter thermophilus doc

Tài liệu Báo cáo khoa học: Enzymatic and electron paramagnetic resonance studies of anabolic pyruvate synthesis by pyruvate: ferredoxin oxidoreductase from Hydrogenobacter thermophilus doc

... Ozawa Y, Nakamura T, Kamata N, Yasujima D, Urushiyama A, Yamakura F, Ohmori D & Imai T (2005) Thermococcus profundus 2-ketoisovalerate ferredoxin oxidoreductase, a key enzyme in the archaeal energy-producing ... The assay mixture without NADH and acetyl-CoA was incubated at 70 °C under an argon atmosphere. The reaction was started by adding the NADH, acetyl-CoA and enzyme solutions...
Ngày tải lên : 16/02/2014, 09:20
  • 10
  • 619
  • 1

Xem thêm

Từ khóa: