Tài liệu Báo cáo khoa học: "PROJECT APRIL -- A PROGRESS REPORT" ppt
Tài liệu Báo cáo khoa học: "PROJECT APRIL -- A PROGRESS REPORT" ppt
... non-terminal alphabet is associated with a transition network, each arc of which is assigned a probability as well as a (non-terminal or terminal) label: the probability estimate for a node labelled ... theoretical linguistics might lead one m imagine. Against this drawback our approach balances the advan- tage of robusmess. No input, no matter how bizarre, can can cause our system simply to fail ... by mathematical treaunents that have so far appeared" and our application does in fact take several liberties with the "pure" algorithm as set out in the literature. ANNEALING...
- 9
- 368
- 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... substantianigra is a neuropathological hallmark of Parkinson’sdisease. This leads to a decreased level of dopamine inthe striatum. As a result, synaptic transmission is nega-tively affected ... jbc.M110.177246.24 Doi H, Okamura K, Bauer PO, Furukawa Y, ShimizuH, Kurosawa M, Machida Y, Miyazaki H, Mitsui K,Kuroiwa Y et al. (2008) RNA-binding protein TLS is a major nuclear aggregate-interacting protein ... of rasagiline, a MAO-B inhib-itor, on the aggregation of a- synuclein, is because of itsaction as a free radical scavenger [36]. Thus, it may bespeculated that dopamine exhibits a beneficial...
- 11
- 754
- 0
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... sequencingand mutational analysis of a gene cluster involved innitrite reduction in Paracoccus denitrificans. AntonieLeeuwenhoek 66, 111–127.13 Kawasaki S, Arai H, Kodama T & Igarashi Y (1997)Gene ... FEBS23 Chang CK (1994) Heme d1and other heme cofactorsfrom bacteria. Ciba Found Symp 180, 228–238.24 Van Spanning RJ, Wancell CW, De Boer T, HazelaarMJ, Anazawa H, Harms N, Oltmann LF & ... total cell lysate and theperiplasmic fraction, but was absent from the membrane and cytoplasmic fractions. (B) The same cell fractions as shown in (A) when sub-jected to SDS ⁄ PAGE analysis and...
- 12
- 613
- 0
Tài liệu Báo cáo khoa học: Stefin A displaces the occluding loop of cathepsin B only by as much as required to bind to the active site cleft doc
... red).Table 1. Average distances between CA atoms of the stefins andcatalytic residues of cysteine proteases.Distance calculated d (A ˚)Papain–stefin B 23.93Cathepsin H–stefin A 23.36 ± 0.23Cathepsin ... Biochemistry andMolecular and Structural Biology, JozefStefan Institute, Jamova 39, SI-1000Ljubljana, SloveniaFax: +386 1 477 3984Tel: +386 1 477 3215E-mail: dusan.turk@ijs.siDatabaseThe coordinates ... theP1 data set is a consequence of highly anisotropic diffrac-tion, which forced us to discard part of the collected datato maintain reasonable merging statistics. The anisotropywas a consequence...
- 8
- 632
- 0
Tài liệu Báo cáo khoa học: S100–annexin complexes – structural insights pptx
... truncated and mutant formsof the annexins (particularly annexin A5 ), as well asannexin–protein complexes. In particular, vertebratestructures of human annexins A1 , A2 , A3 , A5 , A8 andbovine annexins ... interactwith annexins A1 and A2 , respectively, models ofother S100–annexin complexes, such as Ca2+-S10 0A1 1with annexin A6 or calcium-bound dicalcin withannexins A1 , A2 or A5 , are not available. ... vitro data show that dicalcin interacts with ann-exins A1 , A2 and A5 in a calcium-dependent manner[11]. Furthermore, as annexins A1 and A2 utilize theN-terminal helix region to interact with...
- 11
- 347
- 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTGcyc1-z GCATCAGAAAGCATAGGCcyc1-m TGGGAATACGATAGAGTAGnb2 primer GTTTAAACGAGCTCGAATTCCoq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTGSpcoq3-z GTATGCGATGTGGAATTTGSpcoq3-m GATGCCTTCCAATGAATTACcyc1-w GAACCAATGAAATAAGGGCGcyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGCcyc1-y ... GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATCSpcoq7-y GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATGSpcoq7-z CAGGCAAGTCTGTTTATTGSpcoq7-m CTTGGATGAGCTTTCCACSpcoq3-w CGTATAAATTACAATACCGSpcoq3-x GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTGSpcoq3-y...
- 16
- 646
- 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... followed by PCR with Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned into ... 5¢-AAGCTTCCGGAGGCTGCTAGAGAC-3¢ and 5¢-GGATCCAAGAACTGTGTATGTCTG-3¢. The 1.6-kbp full-length Skn cDNA, whose termination codon was changedto a BamHI site, was inserted between the SalI and ... respectively.C25S and C19 9A mutations of Shh were introduced byPCR using primers 5¢-CCTGCAGCAGCGGCAGGCAAGGTTATATAG-3¢ and 5¢-GGGCCCAGAGGCCAGGCCGGGGCACACCAG-3¢, and primers 5¢-GGCATGCTGGCTCGCCTGGCTGTGGAAGCA-3¢...
- 14
- 499
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... 5¢-CTCGAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCAGGGG-3¢ for the latter. The ... organ-specific blood vascular and lymphaticendothelial cells of the mouseTakashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,Nobuaki Yoshida and Hirotake ... LEC, lymphatic endothelial cell; Lyve-1, lymphatic vesselendothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA,paraformaldehyde;...
- 11
- 873
- 0
Tài liệu Báo cáo khoa học: Temperature compensation through systems biology pptx
... Each reaction i is assigned a rate con-stant ki[23] and a steady-state flux (reaction rate) Jiwithassociated activation enthalpy Eki a . Here, reversible reac-tions may be considered as ... the hot-adapted plantshows a relatively large variation in its photosyntheticresponse with a maximum at a relative high tempera-ture, while the cold-adapted plant shows only a smallvariation ... OrdinaryDifferential Equations. NASA Reference Publication1327. Lawrence Livermore National Laboratory ReportUCRL-ID-113855. National Aeronautics and SpaceAdministration, Lewis Research Center,...
- 11
- 380
- 1
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... Seligman PA & Allen RH (1978) Characterization ofthe receptor for transcobalamin II isolated from humanplacenta. J Biol Chem 253, 1766–1772.22 Quadros EV, Nakayama Y & Sequeira JM (2005) ... plasmon resonance.Anal Biochem 305, 1–9.16 Wuerges J, Garau G, Geremia S, Fedosov SN, PetersenTE & Randaccio L (2006) Structural basis for mamma-lian vitamin B12transport by transcobalamin. ... Free ligandswere adsorbed on charcoal, and the absorbance spectrawere recorded. Concentration of appearing IF–CNCbl wascalculated by comparison with the standards IF–H2OCbland IF–CNCbl according...
- 12
- 603
- 0
Từ khóa: báo cáo khoa học tài liệu báo cáo tài liệu báo cáo nghiên cứu khoa họctài liệu về báo cáo khoa họcbáo cáo khoa học tài chính côngBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM